BioMed Research International / 2019 / Article / Tab 1

Research Article

APC-Cdh1 Inhibits the Proliferation and Activation of Oligodendrocyte Precursor Cells after Mechanical Stretch Injury

Table 1

Sequences of primers used for real-time PCR.

Primer5′-3′ Sequence (Forward; Reverse)

Cdh1For: ACTCCGCACTGCTGAAGAAT
Rev: GCTTGCTGCTGAGGGAATAC
Skp2For: TTGGAGGTGGTCTTTTCTGG
Rev: TCTCCTGCTCTGGTTGTGTG
Id2For: TTTCCTCCTACGAGCAGCAT
Rev: CCAGTTCCTTGAGCTTGGAG
β-actinFor: GTCAGGTCATCACTATCGGCAAT
Rev: AGAGGTCTTTACGGATGTCAACGT

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.