Research Article
Assessment of the Antibacterial Effects of Bismuth Nanoparticles against Enterococcus faecalis
Table 1
Oligonucleotide used in this study for identification of
Enterococcus faecalis by PCR [
25].
| Target DNA | Sequence of primer (5-3) | Condition | Amplicon size (pb) |
| 16S rRNA | GTTTATGCCGCATGGCATAAGA G CCGTCAGGGGACGTTCAG | 95°C -2 min; 36 cycles (95°C -30 s; 60°C -60 s; 72°C 60 s) and 72°C -2 min | 310 |
|
|