Effects of Cardiac Sympathetic Neurodegeneration and PPARγ Activation on Rhesus Macaque Whole Blood miRNA and mRNA Expression Profiles

Table 4

Conservation between rhesus macaque and human miRNA sequences of differentially expressed miRNAs. Note that mml-miR-133d-3p is now recognized as mml-miR-133a. Italic and bold letters indicate nucleotides that differ between the rhesus and most similar human miRNA sequences. The bold underscore in the hsa-miR-133a-3p sequence indicates that the 3 end of this sequence ends at ‘g’ and does not include the ‘u’ in the rhesus macaque sequence. n/a, not applicable.

Differentially expressed rhesus miRNAs and most similar human miRNAs	miRNA sequence (5 to 3)
mml-miR-16-2-3p	ccaauauuacugugcugcuuca
hsa-miR-16-2-3p	ccaauauuacugugcugcuuua
mml-miR-204-5p	uucccuuugucauccuaugccu
hsa-miR-204-5p	uucccuuugucauccuaugccu
mml-miR-133d-3p	uugguccccuucaaccagcugu
hsa-miR-133a-3p	uuugguccccuucaaccagcug_
mml-miR-1262-5p	uucuauaaauucauccaucaca
n/a	n/a
mml-miR-146b-5p	ugagaacugaauuccauaggcu
hsa-miR-146b-5p	ugagaacugaauuccauaggcug