BioMed Research International / 2021 / Article / Tab 1

Research Article

DUOX2 As a Potential Prognostic Marker which Promotes Cell Motility and Proliferation in Pancreatic Cancer

Table 1

Primer sequences for RT-qPCR and siRNA of DUOX2.

GenePrimer sequences (5-3) or sequence of siRNA (5-3)

DUOX2ForwardAATGGCCTCCCAGATTTCGG
ReverseCCCCATATCTCGGCCACGTTG
ACTBForwardTGACGTGGACATCCGCAAAG
ReverseTGACGTGGACATCCGCAAAG
DUOX2si1406GGAGGACAACAUAGUGGUUTT
si2848CCAUGAUGCGAUCCUUCAUTT