Research Article
[Retracted] Expression Profile of MAGE-B1 Gene and Its Hypomethylation Activation in Colon Cancer
Table 2
Primer sequences and their expected product size for qRT-PCR.
| Official gene | Primer direction and sequence (from 5➔3) | Ta | Product size | Symbol | Full name |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | Forward: GGGAAGCTTGTCATCAATGG | 58 | 173 bp | Reverse: GAGATGATGACCCTTTTGGC | MAGE-B1 | MAGE family member B1 | Forward: GAAGGCAGATATGCTGAAGG | 125 bp | Reverse: CACTAGGGTTGTCTTCCTTC |
|
|
Abbreviations: Ta: temperature of annealing for each gene; bp: base pair.
|