Table 1: Oligonucleotide primers and sizes of the PCR products for virulence factors of H. pylori.
(a)

PrimerPrimer sequenceAnnealing Temperature (°C)Primer LengthProduct Size (bp)

AspA-FATGCGTATGGAGCATGATTTCATT55.9241401
AspA-RTTTATGCTTTTTGAAAGCGTGAGGGCTT62.228

BabA-FATGAAAAAACACATCCTTTCATTA52.5242192
BabA-RTTATTCAAATACACGCTATAGAGTCTT57.427

CagA-FAATACACCAACGCCTCCAAG57.3201741
CagA-RGCTGACAAAGGAGCACTTCC59.420

HomB-FTACAGACGCTCAAGGCAATG57.3201005
HomB-RTCTATGGGTAGGGCGTTTTG57.320

SabA-FCTCTCTCTCGCTTGCGGTAT59.420187
SabA-RTTGAATGCTTTGCCTCAATG53.220

VacA-FACAAACACACCGCAAAATCA53.2201624
VacA-FAACGGCCACATTAGTGGAAG57.320

(b)

GenderKind of diseaseNumber of patientsAspA+BabA+CagA+HomB+ SabA+VacA+Mean Age

MaleNS21163212439.85±17.11
GU20156001649.4±17.82
FemaleNS25185113447.52±17.01
GU1693010645.93±12.28

(c)

NSGUTotalp value

Number of patients463682-
AspA34 (73.91%)25 (69.44%)59 (71.95%)<0.05
BabA7 (15.21%)9 (25%)16 (19.51%)ns
CagA3 (6.52%)0 (0%)3 (3.65%)ns
HomB2 (4.34%)1 (2.77%)3 (3.65%)ns
SabA5 (10.86%)1 (2.77%)6 (7.31%)ns
VacA12 (26.08%)8 (22.22%)20 (24.39%)ns