Research Article
Analysis of the Complete Genome Sequence of a Novel, Pseudorabies Virus Strain Isolated in Southeast Europe
Table 2
Genetic polymorphism within strain MdBio of PRV.
| Position start | Position end | Length | Change | Coverage | Polymorphism type | Variant frequency (%) | P value |
| 2 690 | 2 712 | 23 | GAGAGGAGATGGGGAGAGGAGAT | 41 ≥ 43 | Deletion | 41.9 ≥ 43.9 | 7.40E-09 | 2 713 | 2 724 | 12 | (GGGAGAGGAGAT)3 ≥ (GGGAGAGGAGAT)2 | 39 ≥ 41 | Deletion (tandem repeat) | 48.8 ≥ 51.3 | 3.30E-10 | 24 258 | 24 258 | 1 | C ≥ T | 80 | SNV (transition) | 26.30 | 5.70E-24 | 101 041 | 101 041 | 1 | C ≥ T | 123 | SNV (transition) | 27.60 | 2.90E-08 |
|
|
Our detailed analysis revealed that there are two insertion/deletion polymorphisms, as well as two polymorphic SNVs in the novel PRV strain.
|