Case Reports in Dentistry / 2014 / Article / Tab 1

Case Report

Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

Table 1

Primers sequence (forward and reverse) of exons of the amelogenin gene and the PCR conditions.

ExonPrimer sequence 5′-3′Fragment size (bp)AT (°C)

2F: AGATTATGTGTGTTTTATGGAGCA23362°C
R: CCCTAATTTCACCAACTATGAGC

3F: TCCTTTAATGTGAACAATTGCAT25057°C
R: TCTGGGATAAAGAATCAACACA

4-5F: AATGAATCTCTTTAACTCCCCATAA36760°C
R: TCCCATTAATGTCTGCATGTG

6F: CCATAATGGCAAAGAAAACAC59959°C
R: TGGTTGTCGGAGACCTTAGAA

7F: TGACAAAACTGAAGCCAGACAT23761°C
R: TGCATTTTATTGTCTGCTAATGG

F: forward; R: reverse; bp: base pairs; AT: annealing temperature.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.