Cardiology Research and Practice / 2019 / Article / Tab 1

Research Article

Primary Mechanism Study of Panax notoginseng Flower (Herb) on Myocardial Infarction in Rats

Table 1

Information on primers.

IDPrimerPrimer sequence (5′ to 3′)nmolPurified method

NM_031836.2VEGFA rat leftaaaaacgaaagcgcaagaaa200PAGE
VEGFA rat rightTttctccgctctgaacaagg200PAGE
NM_024359.1Hypoxia-inducible factor-1 rat leftaagcactagacaaagctcacctg200PAGE
Hypoxia-inducible factor-1 rat rightTtgaccatatcgctgtccac200PAGE
NM_013062.1KDR rat leftggagattgaaagaaggaacgag200PAGE
KDR rat rightTggtacatttctggggtggt200PAGE

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.