Table of Contents Author Guidelines Submit a Manuscript
Disease Markers
Volume 2014 (2014), Article ID 678246, 4 pages
http://dx.doi.org/10.1155/2014/678246
Research Article

The CCR5Δ32 Polymorphism in Brazilian Patients with Sickle Cell Disease

1Department of Clinical Pathology, School of Medical Sciences, State University of Campinas (UNICAMP), 13083-970 Campinas, SP, Brazil
2Pernambuco Hematology and Hemotherapy Center, HEMOPE Foundation, 52011-900 Recife, PE, Brazil
3Hematology and Hemotherapy Center, UNICAMP, 13083-878 Campinas, SP, Brazil

Received 2 September 2014; Accepted 23 October 2014; Published 11 November 2014

Academic Editor: Giuseppe Murdaca

Copyright © 2014 Mariana Pezzute Lopes et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background. Previous studies on the role of inflammation in the pathophysiology of sickle cell disease (SCD) suggested that the CCR5Δ32 allele, which is responsible for the production of truncated C-C chemokine receptor type 5 (CCR5), could confer a selective advantage on patients with SCD because it leads to a less efficient Th1 response. We determined the frequency of the CCR5Δ32 polymorphism in 795 Afro-Brazilian SCD patients followed up at the Pernambuco Hematology and Hemotherapy Center, in Northeastern Brazil, divided into a pediatric group (3 months–17 years, ) and an adult group (18–70 years, ). The adult patients were also compared to a healthy control group (blood donors, 18–61 years, ). Methods. The CCR5/CCR5Δ32 polymorphism was determined by allele-specific PCR. Results. No homozygous patient for the CCR5Δ32 allele was detected. The frequency of heterozygotes in the study population (patients and controls) was 5.8%, in the total SCD patients 5.1%, in the children 5.4%, in the adults with SCD 4.8%, and in the adult controls 8.1%. These differences did not reach statistical significance. Conclusions. Our findings failed to demonstrate an important role of the CCR5Δ32 allele in the population sample studied here.

1. Introduction

Sickle cell disease (SCD) is caused by either homozygosity for the hemoglobin S (HbS) gene (sickle cell anemia, SCA) or compound heterozygosity for HbS and another structural hemoglobin variant or beta-thalassemia [1, 2].

HbS results from a single nucleotide substitution (GAG → GTG) at the sixth codon of the β-globin gene (HBB), which causes glutamic acid to be replaced by valine at the sixth position of the polypeptide chain [35]. The mutation originated in Africa and is therefore more common in Brazilian populations where there is a greater proportion of individuals of African descent [6]. The pathophysiology of SCD is based on the polymerization of deoxygenated HbS, leading to chronic hemolysis and vasoocclusive episodes [68]. It has been suggested that these episodes are associated with a chronic inflammatory condition with abnormal endothelial function involving interactions between the endothelium and sickle reticulocytes and white blood cells and thrombocytes. SCD patients have elevated levels of inflammatory mediators, such as IL-6 and TNF-α, and adhesive molecules [9]. A growing number of studies investigating the importance of the immune system in the pathophysiology of SCD have suggested that inflammation and morbidity are closely associated in this disease [10, 11]. The CCR5 gene, which encodes CCR5, a Th1-cell-associated chemokine receptor, has been associated with chronic inflammatory states [12]. The gene is located on chromosome 3 and has a mutant allele with a 32 bp deletion known as CCR5Δ32, which leads to truncation and loss of the receptor on the cell surface [13, 14]. As the Th1 immune response is associated with inflammation, it has been proposed that the CCR5Δ32 allele could confer a selective advantage on patients with SCD because it induces a less efficient Th1 response [15]. Therefore, our hypothesis is that the prevalence of CCR5Δ32 allele would increase with advancing patient age. Thus, in order to investigate if the CCR5Δ32 polymorphism could confer a selective advantage on its carriers, we compared the frequencies of the CCR5Δ32 allele between two groups of SCD patients (pediatric and adult), seen at the Pernambuco Hematology and Hemotherapy Center, HEMOPE, in Northeastern Brazil, as well as the SCD adult group and a normal control group formed by blood donors.

2. Methods

A total of 795 DNA samples from Afro-Brazilian SCD patients between 3 months and 70 years of age (631 HbSS, 91 HbSC, 73 HbS/β thalassemia; 50.4% male) followed up regularly at HEMOPE were analyzed. The HEMOPE Foundation Ethics Committee approved this study (n° 017/06), and informed consent was obtained from all participants or those legally responsible for them.

The patients were split into a pediatric group (3 months to 17 years old) with 483 individuals and an adult group (18 to 70 years old) with 312 individuals. An adult control group of 247 DNA samples from healthy blood donors (18 to 61 years old; 82.2% males) from the same geographical region and with ethnic background similar to those of the patients was analyzed for the CCR5Δ32 polymorphism. The control group was compared with the adult patients and the analyses were adjusted for age and sex.

2.1. Analysis of the CCR5Δ32 Polymorphism

To analyze the CCR5 polymorphism, genomic DNA was extracted from leukocytes using a commercially available kit according to the manufacturer’s instructions (GFX Genomic Blood DNA Purification Kit, GE Healthcare, Little Chalfont, Buckinghamshire, UK). The CCR5Δ32 deletion was detected by polymerase chain reaction (PCR) adapted from Chies and Hutz [15], using the following CCR5-specific primers: CCR5Δ32_F-5′ CTTGGGTGGTGGCTGTGTTT 3′ and CCR5Δ32_R-5′ AGTTTTTAGGATTCCCGATAGC 3′.

The PCR reactions were carried out in a Veriti Thermal Cycler (Life Technologies) in a final volume of 30,0 μL containing 0.05 U Taq DNA polymerase; 0.1 mM dNTPs; 100 nM of each primer; 3.0 mM of MgCl2; 1x Taq buffer; 200 ng of DNA and deionized water for 30 cycles (96°C for 30 seconds, 66°C for 30 seconds, and 72°C for 1 minute). The amplified products were run on a 3% agarose gel stained with ethidium bromide and visualized under UV light. The amplification products are shown in Figure 1. Amplification of the normal CCR5 allele produced a 206 bp fragment, while amplification of the mutant allele (CCR5Δ32) produced a 174 bp fragment.

678246.fig.001
Figure 1: Agarose gel showing the CCR5 gene products in samples from a population of SCD patients in the state of Pernambuco. M: 100 bp ladder; P1 and P5: CCR5Δ32 heterozygotes (patients); P2–P4 and P6–P8: patients without the deletion (normal alleles); C: CCR5Δ32 heterozygotes (controls); B: reaction blank.
2.2. Statistical Analysis

The statistical analysis was carried out with SAS 9.2 for Windows. The chi-square test (χ2) was used to determine whether the gene distribution in the individuals studied was in Hardy-Weinberg equilibrium. To compare proportions, the chi-square test and Fisher exact test were used. A significance level of 5% was used for all the statistical tests.

3. Results

The CCR5 gene was in Hardy-Weinberg equilibrium in both patient groups and controls ( and , resp.). None of the patients or controls was homozygous for the CCR5Δ32 allele. The frequency of heterozygotes in the study population (patients and controls) was 5.8% (61 individuals), corresponding to an allelic frequency of 2.9%. Of the 795 SCD patients, 41 (5.1%) were heterozygous (allelic frequency of 2.55%), with 26 (5.4%) being in the pediatric group and 15 (4.8%) in the adult group. In the control group, 20 individuals (8.1%) had the CCR5Δ32 polymorphism, corresponding to an allelic frequency of 4.05%.

Statistical comparisons of the pediatric and adult groups (5.4% versus 4.8%, resp.; ) and of the adult group and the respective controls (4.8% versus 8.1% resp.; ) failed to identify any statistically significant differences.

4. Discussion

The CCR5Δ32 allele is considered to be associated with Caucasians and to have originated in Europe around 7000 years ago [16]. Its frequency varies widely around the world, but it is much lower in populations of American, African, and East Asian origin [1723]. Its presence seems to confer an advantage on certain populations in the face of environmental changes [20] or, in contrast, be a risk factor for developing certain infections [21]. According to some authors, the distribution of the CCR5Δ32 allele therefore depends on genetic and environmental interactions that result in an advantage or disadvantage for its carriers [22].

In Brazil, the contributions of Amerindian, African, European, and, later, Asian genes are reflected in distinct genetic patterns in the different regions of the country. In our study, the total frequency of heterozygous individuals for the CCR5Δ32 deletion in the region of Brazil, where the pattern of migration involves intense flows of European and African populations, as well as significant miscegenation between these populations, was 5.8%, corresponding to an allelic frequency of 2.9%. Other studies show that this frequency is dependent on the population and geographical region studied [15, 2432].

The role of the CCR5Δ32 polymorphism as a protective factor against disease is subject of controversy. Initially, the polymorphism was associated with resistance to HIV infection in individuals who were homozygous for the polymorphism and to slower progression of HIV infection in heterozygotes [33]. Clinical trials with CCR5 inhibitor in AIDS patients are in progress, showing that the receptor has gained clinical importance [34, 35].

Because it modulates the inflammatory response, the CCR5Δ32 allele has also been studied as a genetic marker related to pathologies where the inflammatory component is important, as coronary artery disease, myocardial infarction, atherosclerosis, rheumatoid arthritis, primary Sjögren’s syndrome, and asthma [3641].

Regarding SCD, there are few studies investigating if the mutant CCR5 allele could confer a selective advantage on patients. Chies and Hutz, studying 79 SCA patients (53 from the Northeast and 26 from the South of Brazil), found a relatively high prevalence of the CCR5Δ32 allele (5.1%) compared with healthy controls from the same ethnic group (1.3%) [15]. Vargas et al. [42] reported a frequency of 5.0% for CCR5Δ32 heterozygotes in SCA patients from the Southern Brazil compared with only 2% in normal controls. Differently, our results did not show any significant difference between the frequencies of CCR5Δ32 heterozygotes of the adult and the pediatric populations (5.4% versus 4.8%; ), as well as adult patients and adult controls (4.8% versus 8.1%; ). However, the sample size analyzed here (795 SCD patients), besides a less heterogeneous ethnic origin (since all patients came from the same Brazilian state, Pernambuco), confers consistency on these results.

5. Conclusions

In conclusion, our data show once more that the frequency of the CCR5Δ32 allele varies in the Brazilian population, reflecting the history of immigration from very varied ethnic backgrounds. However, after studying 795 patients, from the Northeastern region of the country, we failed to find any significant result which could suggest that the presence of the CCR5Δ32 mutant allele contributes to the development of a less aggressive spectrum of SCD and confers an important selective advantage on its carriers in this population.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Authors’ Contribution

Mariana Pezzute Lopes and Magnun Nueldo Nunes Santos contributed equally to this study.

Acknowledgments

This work was supported by the State of São Paulo Research Foundation (FAPESP) (Grant nos. 2008/57441-0 and 2011/02622-3), the National Council for Scientific and Technological Development (CNPq) (Grant no. 472127/2007-1), and the Agency for the Support and Evaluation of Graduate Education (CAPES) (Brazil). The authors thank Mrs. C. A. M. Silva of the Statistical Advice Service, School of Medical Sciences, UNICAMP.

References

  1. M. H. Steinberg, “Pathophysiologically based drug treatment of sickle cell disease,” Trends in Pharmacological Sciences, vol. 27, no. 4, pp. 204–210, 2006. View at Publisher · View at Google Scholar · View at Scopus
  2. M. H. Steinberg, “Sickle cell anemia, the first molecular disease: overview of molecular etiology, pathophysiology, and therapeutic approaches,” The Scientific World Journal, vol. 8, pp. 1295–1324, 2008. View at Publisher · View at Google Scholar · View at Scopus
  3. C. A. Marotta, J. T. Wilson, B. J. Forget, and S. M. Weissman, “Human β globin messenger RNA III. Nucleotide sequences derived from complementary DNA,” The Journal of Biological Chemistry, vol. 252, no. 14, pp. 5040–5053, 1977. View at Google Scholar · View at Scopus
  4. M. H. Steinberg and C. Brugnara, “Pathophysiological-based approaches to treatment of sickle cell disease,” Annual Review of Medicine, vol. 54, pp. 89–112, 2003. View at Publisher · View at Google Scholar · View at Scopus
  5. M. F. de Sonati and F. F. Costa, “The genetics of blood disorders: hereditary hemoglobinopathies,” Jornal de Pediatria, vol. 84, no. 4, pp. S40–S51, 2008. View at Publisher · View at Google Scholar · View at Scopus
  6. M. A. Zago and A. C. S. Pinto, “The pathophysiology of sickle cell disease: from the genetic mutation to multiorgan disfunction,” Revista Brasileira de Hematologia e Hemoterapia, vol. 29, no. 3, pp. 207–214, 2007. View at Google Scholar · View at Scopus
  7. S. H. Embury, “The not-so-simple process of sickle cell vasoocclusion,” Microcirculation, vol. 11, no. 2, pp. 101–113, 2004. View at Publisher · View at Google Scholar · View at Scopus
  8. D. C. Rees, T. N. Williams, and M. T. Gladwin, “Sickle-cell disease,” The Lancet, vol. 376, no. 9757, pp. 2018–2031, 2010. View at Publisher · View at Google Scholar · View at Scopus
  9. A. Kutlar, “Sickle cell disease: a multigenic perspective of a single-gene disorder,” Medical Principles and Practice, vol. 14, supplement 1, pp. 15–19, 2005. View at Publisher · View at Google Scholar · View at Scopus
  10. J. A. B. Chies and N. B. Nardi, “Sickle cell disease: a chronic inflammatory condition,” Medical Hypotheses, vol. 57, no. 1, pp. 46–50, 2001. View at Publisher · View at Google Scholar · View at Scopus
  11. R. P. Hebbel, R. Osarogiagbon, and D. Kaul, “The endothelial biology of sickle cell disease: inflammation and a chronic vasculopathy,” Microcirculation, vol. 11, no. 2, pp. 129–151, 2004. View at Publisher · View at Google Scholar · View at Scopus
  12. A. E. Vargas, A. R. Marrero, F. M. Salzano, M. C. Bortolini, and J. A. B. Chies, “Frequency of CCR5Δ32 in Brazilian populations,” Brazilian Journal of Medical and Biological Research, vol. 39, no. 3, pp. 321–325, 2006. View at Publisher · View at Google Scholar · View at Scopus
  13. R. Liu, W. A. Paxton, S. Choe et al., “Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection,” Cell, vol. 86, no. 3, pp. 367–377, 1996. View at Publisher · View at Google Scholar · View at Scopus
  14. M. Benkirane, D.-Y. Jin, R. F. Chun, R. A. Koup, and K.-T. Jeang, “Mechanism of transdominant inhibition of CCR5-mediated HIV-1 infection by ccr5Δ32,” The Journal of Biological Chemistry, vol. 272, no. 49, pp. 30603–30606, 1997. View at Publisher · View at Google Scholar · View at Scopus
  15. J. A. B. Chies and M. H. Hutz, “High frequency of the CCR5delta32 variant among individuals from an admixed Brazilian population with sickle cell anemia,” Brazilian Journal of Medical and Biological Research, vol. 36, no. 1, pp. 71–75, 2003. View at Google Scholar · View at Scopus
  16. K. Lidén, A. Linderholm, and A. Götherström, “Pushing it back. Dating the CCR5-D32 bp deletion to the Mesolithic in Sweden and its implications for the Meso/Neo transition,” Documenta Praehistorica, vol. 33, pp. 29–37, 2006. View at Google Scholar
  17. M. Samson, F. Libert, B. J. Doranz et al., “Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene,” Nature, vol. 382, no. 6593, pp. 722–726, 1996. View at Publisher · View at Google Scholar · View at Scopus
  18. F. Libert, P. Cochaux, G. Beckman et al., “The Δccr5 mutation conferring protection against HIV-1 in Caucasian populations has a single and recent origin in Northeastern Europe,” Human Molecular Genetics, vol. 7, no. 3, pp. 399–406, 1998. View at Publisher · View at Google Scholar · View at Scopus
  19. G. Lucotte, “Frequencies of 32 base pair deletion of the (32) allele of the CCR5 HIV-1 co-receptor gene in Caucasians: a comparative analysis,” Infection, Genetics and Evolution, vol. 1, no. 3, pp. 201–205, 2002. View at Publisher · View at Google Scholar · View at Scopus
  20. A. P. Galvani and J. Novembre, “The evolutionary history of the CCR5-Delta32 HIV-resistance mutation,” Microbes and Infection, vol. 7, no. 2, pp. 302–309, 2005. View at Publisher · View at Google Scholar · View at Scopus
  21. A. E. Vargas, G. Cechim, J. F. Correa et al., “Pros and cons of a missing chemokine receptor-Comments on “Is the European spatial distribution of the HIV-1-resistant CCR5-Δ32 allele formed by a breakdown of the pathocenosis due to the historical Roman expansion?” by Eric Faure and Manuela Royer-Carenzi (2008),” Infection, Genetics and Evolution, vol. 9, no. 4, pp. 387–389, 2009. View at Publisher · View at Google Scholar · View at Scopus
  22. E. Faure and M. Royer-Carenzi, “Is the European spatial distribution of the HIV-1-resistant CCR5-Δ32 allele formed by a breakdown of the pathocenosis due to the historical Roman expansion?” Infection, Genetics and Evolution, vol. 8, no. 6, pp. 864–874, 2008. View at Publisher · View at Google Scholar · View at Scopus
  23. J. J. Martinson, N. H. Chapman, D. C. Rees, Y.-T. Liu, and J. B. Clegg, “Global distribution of the CCR5 gene 32-basepair deletion,” Nature Genetics, vol. 16, no. 1, pp. 100–103, 1997. View at Publisher · View at Google Scholar · View at Scopus
  24. F. A. D. P. L. Carvalhaes, G. L. Cardoso, I. G. Hamoy, T. L. Yan, and J. F. Guerreiro, “Distribution of CCR5-Δ32, CCR2-64I, and SDF1-3′A mutations in populations from the Brazilian Amazon region,” Human Biology, vol. 76, no. 4, pp. 643–646, 2004. View at Publisher · View at Google Scholar · View at Scopus
  25. M. W. P. Carvalho, A. P. M. Leboute, S. F. Oliveira, S. M. B. Sousa, M. de Nazaré Klautau-Guimarães, and A. L. Simões, “CCR5D32 mutation in three Brazilian populations of predominantly Sub-Saharan African ancestry,” Genetics and Molecular Biology, vol. 27, no. 3, pp. 321–325, 2004. View at Publisher · View at Google Scholar · View at Scopus
  26. A. B. W. Boldt, L. Culpi, L. T. Tsuneto, I. R. Souza, J. F. J. Kun, and M. L. Petzl-Erler, “Analysis of the CCR5 gene coding region diversity in five South American populations reveals two new non-synonymous alleles in Amerindians and high CCR5*D32 frequency in Euro-Brazilians,” Genetics and Molecular Biology, vol. 32, no. 1, pp. 12–19, 2009. View at Publisher · View at Google Scholar · View at Scopus
  27. S. L. M. Teixeira, F. I. Bastos, M. A. Hacker, and M. G. Morgado, “Distribution of CCR5 genotypes and HLA Class I B alleles in HIV-1 infected and uninfected injecting drug users from Rio de Janeiro, Brazil,” Infection, Genetics and Evolution, vol. 9, no. 4, pp. 638–642, 2009. View at Publisher · View at Google Scholar · View at Scopus
  28. V. C. Vieira, M. F. M. Barral, R. A. Mendoza-Sassi, J. M. Silveira, M. A. Soares, and A. M. B. de Martínez, “The effect of combined polymorphisms in chemokines and chemokine receptors on the clinical course of HIV-1 infection in a Brazilian population,” Memórias do Instituto Oswaldo Cruz, vol. 106, no. 4, pp. 408–415, 2011. View at Publisher · View at Google Scholar · View at Scopus
  29. R. Grimaldi, N. Shindo, A. X. Acosta et al., “Prevalence of the CCR5Δ32 mutation in Brazilian populations and cell susceptibility to HIV-1 infection,” Human Genetics, vol. 111, no. 1, pp. 102–104, 2002. View at Publisher · View at Google Scholar · View at Scopus
  30. P. O. Rigato, M. A. Hong, J. Casseb et al., “Better CD4+ T cell recovery in Brazilian HIV-infected individuals under HAART due to commulative carriage of SDF-1-3′A, CCR2-V64I, CCR5-D32 and CCR5-promoter 59029A/G Polymorphisms,” Current HIV Research, vol. 6, no. 5, pp. 466–473, 2008. View at Publisher · View at Google Scholar · View at Scopus
  31. T. Hünemeier, A. G. Neves, I. Nornberg et al., “T-cell and chemokine receptor variation in South Amerindian populations,” American Journal of Human Biology, vol. 17, no. 4, pp. 515–518, 2005. View at Publisher · View at Google Scholar · View at Scopus
  32. J. D. de Farias, M. G. Santos, A. K. de França et al., “Distribution of the CCR5delta32 allele (gene variant CCR5) in Rondônia, Western Amazonian region, Brazil,” Genetics and Molecular Biology, vol. 35, no. 1, pp. 27–31, 2012. View at Publisher · View at Google Scholar · View at Scopus
  33. K. L. Jones, J. J. Maguire, and A. P. Davenport, “Chemokine receptor CCR5: from AIDS to atherosclerosis,” British Journal of Pharmacology, vol. 162, no. 7, pp. 1453–1469, 2011. View at Publisher · View at Google Scholar · View at Scopus
  34. M. Pichenot, S. Deuffic-Burban, L. Cuzin, and Y. Yazdanpanah, “Efficacy of new antiretroviral drugs in treatment-experienced HIV-infected patients: a systematic review and meta-analysis of recent randomized controlled trials,” HIV Medicine, vol. 13, no. 3, pp. 148–155, 2012. View at Publisher · View at Google Scholar · View at Scopus
  35. P. Dorr, M. Westby, S. Dobbs et al., “Maraviroc (UK-427,857), a potent, orally bioavailable, and selective small-molecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human immunodeficiency virus type 1 activity,” Antimicrobial Agents and Chemotherapy, vol. 49, no. 11, pp. 4721–4732, 2005. View at Publisher · View at Google Scholar · View at Scopus
  36. Z. E. Karaali, S. Sozen, M. Yurdum et al., “Effect of genetic variants of chemokine receptors on the development of myocardial infarction in Turkish population,” Molecular Biology Reports, vol. 37, no. 7, pp. 3615–3619, 2010. View at Publisher · View at Google Scholar · View at Scopus
  37. Q. Zhao, “Dual targeting of CCR2 and CCR5: therapeutic potential for immunologic and cardiovascular diseases,” Journal of Leukocyte Biology, vol. 88, no. 1, pp. 41–55, 2010. View at Publisher · View at Google Scholar · View at Scopus
  38. I. Zapico, E. Coto, A. Rodríguez, C. Alvarez, J. C. Torre, and V. Alvarez, “CCR5 (chemokine receptor-5) DNA-polymorphism influences the severity of rheumatoid arthritis,” Genes & Immunity, vol. 1, no. 4, pp. 288–289, 2000. View at Publisher · View at Google Scholar · View at Scopus
  39. J. A. Zúñiga, C. Villareal-Garza, E. Flores et al., “Biological relevance of the polymorphism in the CCR5 gene in refractory and non-refractory rheumatoid arthritis in Mexicans,” Clinical and Experimental Rheumatology, vol. 21, no. 3, pp. 351–354, 2003. View at Google Scholar · View at Scopus
  40. M. Petrek, Z. Cermáková, B. Hutyrová et al., “CC chemokine receptor 5 and interleukin-1 receptor antagonist gene polymorphisms in patients with primary Sjögren's syndrome,” Clinical and Experimental Rheumatology, vol. 20, no. 5, pp. 701–703, 2002. View at Google Scholar · View at Scopus
  41. P. Srivastava, P. J. Helms, D. Stewart, M. Main, and G. Russell, “Association of CCR5δ32 with reduced risk of childhood but not adult asthma,” Thorax, vol. 58, no. 3, pp. 222–226, 2003. View at Publisher · View at Google Scholar · View at Scopus
  42. A. E. Vargas, M. A. L. Da Silva, L. Silla, and J. A. B. Chies, “Polymorphisms of chemokine receptors and eNOS in Brazilian patients with sickle cell disease,” Tissue Antigens, vol. 66, no. 6, pp. 683–690, 2005. View at Publisher · View at Google Scholar · View at Scopus