Disease Markers / 2016 / Article / Tab 1

Research Article

Evaluation of MTBDRplus and MTBDRsl in Detecting Drug-Resistant Tuberculosis in a Chinese Population

Table 1

PCR and DNA sequencing primers.

LocusPrimerSequence (5′ to 3′)Size (bp)PositionProduct (bp)

Rv0577Rv0577-fATGCCCAAGAGAAGCGAATACAGGCAA27671166⋯671192786
Rv0577-rCTATTGCTGCGGTGCGGGCTTCAA24671951⋯671928786

16s rRNA16SrRNA-fACGGTGGGTACTAGGTGTGGGTTTC251472650–674543
16SrRNA-rTCTGCGATTACTAGCGACTCCGACTTCA281473192–165543

rpoBrpoB-fCTTGCACGAGGGTCAGACCA20760829⋯760848543
rpoB-rATCTCGTCGCTAACCACGCC20761371⋯761352543

inhA
(promoter)
inhA-fTGCCCAGAAAGGGATCCGTCATG232154886⋯2154905455
inhA-rATGAGGAATGCGTCCGCGGA202155340⋯2155321455

katGkatG-fAACGACGTCGAAACAGCGGC202154886⋯2154905455
katG-rGCGAACTCGTCGGCCAATTC202155340⋯2155321455

gyrAgyrA-fCCCTGCGTTCGATTGCAAAC207273⋯7292423
gyrA-rCTTCGGTGTACCTCATCGCC207695⋯7676423

embBembB-fCTGACCGACGCCGTGGTGATAT224247345⋯4247366490
embB-rTGAATGCGGCGGTAACGACG204247834⋯4247815490

rrsrrs-rGTCCGAGTGTTGCCTCAGG191473518⋯1473500516
rrs-fGTCAACTCGGAGGAAGGTGG201473003⋯1473022516

eiseis-rGCGTAACGTCACGGCGAAATTC222715477⋯2715456567
eis-fGTCAGCTCATGCAAGGTG182714911⋯2714928567

gyrBgyrB-fAAGACCAAGTTGGGCAACAC206353⋯6372609
gyrB-rCTGCCACTTGAGTTTGTACA206961⋯6942609

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.