Disease Markers / 2019 / Article / Tab 1

Research Article

Coding Region Mutation Screening in Optineurin in Chinese Normal-Tension Glaucoma Patients

Table 1

Oligonucleotide primers used for PCR and sequencing of OPTN in NTG patients.

PrimerSequence (5 to 3)Amplicon Size (bp)MgCl2 (mM)Anneal Temp (°C)

1OPTN-3/4FTTTCTGAAGCTACATATACCTTT4452.562-55 (TD)
OPTN-3/4RCTCACCACCAAGCCTTAGTG
2OPTN-5FAGCCATGTGGTCAAGTGGAC3621.562-55 (TD)
OPTN-5RAAGATTCCACTGCAAATGTCAA
3OPTN-6FGTGCCCAGCCTTAGTTTGATC3361.558
OPTN-6RAATCCTTGGCTTGTGTTGACA
4OPTN-7FTTGTGTTAAATCCCTTGCATTT2021.555
OPTN-7RCCTCAGGTCACAACATTTGAC
5OPTN-8FCAGTTCCTTTAAGCTGGTCC3811.558
OPTN-8RTTGCACAAGCCTGGAATATTC
6OPTN-9FCCTGATCCTTTATCCCAATTGT2441.558
OPTN-9RGTAGTGGCCGTGGAATCTTA
7OPTN-10FGGCTACTAATGGTTCAGCCTG2391.562-55 (TD)
OPTN-10RGGAGGATAAAATTGCTCTCTCA
8OPTN-11FTGCGACGTAAAGGAGCATTG2301.562-55 (TD)
OPTN-11RTCGCTGCCCTTCTGACTCAA
9OPTN-12FTGGGAGGCAAGACTATAAGTTT2211.555
OPTN-12RCGTTCAACAGTTTCTGTTCATT
10OPTN-13FCAGGCAGAATTATTTCAAAAC2732.562-55 (TD)
OPTN-13RTTTCCAATGCGAGAATACAG
11OPTN-14FCTCCTCATCGCATAAACACTGT2671.558
OPTN-14RGGCACCTCTTCTACGGCC
12OPTN-15FACTTCTGTGGACTGTCTGCTC2631.562-55 (TD)
OPTN-15RTGATTTGGAATCCATTGTAGAG
13OPTN-16FTCGCCATCTGTTCTTCAAGT2721.558
OPTN-16RCACAAAAGCACAACTCTTGGA

TD: touchdown PCR using a cycling program where the annealing temperature is gradually reduced by 0.2°C per cycle.

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.