Research Article
Anticancer Potentials of Root Extract of Polygala senega and Its PLGA Nanoparticles-Encapsulated Form
Table 1
Primer sequences of cancer-related genes (human origin) used in this study.
| Primer name | Primer sequences |
| -actin | Catalogue number-117816,GeNei (purchased from Bangalore GeNei) | Survivin | F: ATGACGACCCCATGCAAA | R: AGGATTTAGGCCACTGCCTT | PCNA | Catalogue number-117813,GeNei (purchased from Bangalore GeNei | Caspase-3 | F: AGGCGGTTGTAGAAGTTAATAAAGGT | R: AGCGACTGGATGAACCAGGA | p53 | Catalogue number-117810,GeNei (purchased from Bangalore GeNei) |
|
|