Original Article

Development of Randomly Amplified Polymorphic DNA Based SCAR Marker for Identification of Ipomoea mauritiana Jacq (Convolvulaceae)

Table 2

Details of the I. mauritiana specific SCAR marker designed from the 600-bp polymorphic sequence.

Name of random decamer primer usedSequence of random decamer primer (5′-3′)Name of the SCAR primerSequence of the SCAR primer (5′-3′)Annealing temperature (°C)

OPA18AGGTGACCGTIM1FACTTGGGATAGGCTGACACG60
IM1RGGTAAACCGGGATGGTTCTT60