Table 1: Gene-specific primers and probes for α-globin, β-globin, β-actin, and 18S rRNA.

Name of primerSequence of primer 5′-3′

Hbα1 sense-221FTCCGCTCCGGTGAGGAA
Hbα1 antisense-323RGCTCGCTGTATTTGGAGAGGAA
Hbα1 TaqMan probe-273T6-FAM-CCGTCGGACACATGGATGATCTTCAA-TAMRA
Hbα2 sense-261FGGGCATGGGCGTGAAAT
Hbα2 antisense-329RAAGGCGTGCAGCTCACTGA
Hbα2 TaqMan probe-279T6-FAM-CATCGTTACTCTCACCGAAGCCAT-TAMRA
Hbβ1 sense-FCATGGTCCAGTGGACAGATAGT
Hbβ1 antisense-RCTCCCCCACATCGATTTTTC
Hbβ1 TaqMan probe-T6-FAM-AGCGCAGCGCCATCATTTCCCTTTG-TAMRA
Hbβ2 sense-30FCATGGTCCAGTGGACAGATAGC
Hbβ2 antisense-100RTCTCCCCCACATCGATTTTC
Hbβ2 TaqMan probe-53T6-FAM-AGCGCAGCTCCATCATTGCCCTATG-TAMRA
Actin sense-352FAAGATGACCCAGATCATGTTCGA
Actin antisense-454RCGATACCAGTGGTACGACCAGA
Actin TaqMan probe-382T6-FAM-AACACCCCCGCCATGTACGTTGC- TAMRA
18S sense-625FTCGTAGTTCCGACCGTAAACG
18S antisense-691RGCCCGGCGGGTCAT
18S TaqMan probe-649T6-FAM-CCAACTAGCGATCCGGCGG-TAMRA