Table 2: Sequences of primers and the sizes of the products.

PrimerDirectionSequences (5 to 3)Product size (bp)

GAPDHForwardTCAAGAAGGTGGTGAAGCAG 111
ReverseAGGTGGAAGAATGGGAGTTG
COX-2ForwardCCAAACCAGCAGGCTCATACT 183
ReverseAGCGGATGCCAGTGATAGAGT
iNOSForwardACCAAACTGTGTGCCTGGAGGT 174
ReverseTGTGCGTCTCTTCCGTGGCAAA
TNF-αForwardTGCTCAGAAACACACGAGACGC 184
ReverseTTCAGCAGCCTTGTGAGCCAGA
IL-6ForwardTGCTCTGGTCTTCTGGAGTTCCG 182
ReverseAGGAGAGCATTGGAAGTTGGGGT