Table 1: The base sequences of primers used for quantitative real-time PCR.

Primer nameSequence

Notch-1
 ForwardCACTGTGGGCGGGTCC
 ReverseGTTGTATTGGTTCGGCACCAT
Hes1
 ForwardAGCCAACTGAAAACACCTGATT
 ReverseGGAGTTTATGATTAGCAGTGG
Dll4
 ForwardGGTGACCTGGCGAACAGACGAGCAAAAT
 ReverseGGTGACCTGGCGAACAGACGAGCAAAAT
GAPDH
 ForwardGGCATCCTGGGCTACACT
 ReverseCCACCACCCTGTTGCTGT