Evidence-Based Complementary and Alternative Medicine / 2014 / Article / Tab 1

Research Article

Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice

Table 1

Primer sequences and PCR conditions.

Gene descriptionPrimersSequences (5′-3′) (°C)Size (bp)

SFRP 5FCTTGGTGTCCTTGCGCTTTA61155
RCTGATGGCCTCATGGAACAG
DKK2FTCATTCCCTGTTCTTCAGCG55144
RGCATTTCCTTCAGATTGGCA
WNT10bFTTTTGGCCACTCCTCTTCCT61183
RTCCTTTTCCAACCGAAAACC
GalaninFGAGCCTTGATCCTGCACTGA60121
RAGTGGCTGACAGGGTCACAA
GalR1FCCAAGGGGGTATCCCAGTAA60147
RGGCCAAACACTACCAGCGTA
GalR2FATAGTGGTGCTCATGCTGGAA60134
RAGGCTGGATCGAGGGTTCTA
PKC FCTGAGCGCTGCAAGAAGAAC60146
RTGGAAACTTTGATCCTGCACTGA
Cyc-DFTGGGAAGTTTTGTTGGGTCA55144
RTCCTTGTCCAGGTAATGCCA
PPAR 2FTTCGGAATCAGCTCTGTGGA55148
RCCATTGGGTCAGCTCTTGTG
C/EBP FAAGGCCAAGAAGTCGGTGGA55189
RCCATAGTGGAAGCCTGATGC
FASFTTGCCCGAGTCAGAGAACC55171
RCGTCCACAATAGCTTCATAGC
LeptinFCTCCAAGGTTGTCCAGGGTT55143
RAAAACTCCCCACACAATGGG
CD36FATGACGTGGCAAAGAACAGC55160
RGAAGGCTCAAAGATGCCTCC
aP2FACATGAAAGTGGGAGTG55128
RAAGTACTCTCTGACCGGATG
TLR2FTCTAAAGTCGATCCGCGACAT55344
RTACCCAGCTCGCTCACTACGT
TLR4FACCTCTGCCTTCACTACAGA48.6223
RAGGGACTTCTCAACCTTCTC
TNF FTGTCTCAGCCTCTTCTCATT55156
RAGATGATCTGAGTGTGAGGG
MCP1FCCAGCAAGATGATCCCAATG55450
RCTTCTTGGGGTCAGCACAGA
IFN FATGGCTAGGCTCTGTGCTTTCCT58638
RGGGCTCTCCAGATTTCTGCTCTG
IFN FCCACAGCCCTCTCCATCAACTATAAGC56372
RAGCTCTTCAACTGGAGAGCAGTTGAGG
IL-6FTTGCCTTCTTGGGACTGATG55162
RCCACGATTTCCCAGAGAACA
GAPDHFAGAACATCATCCCTGCATCC60321
RTCCACCACCCTGTTGCTGTA

SFRP 5: secreted frizzled-related protein 5; DKK2: Dickkopf 2; WNT10b: wingless-type MMTV integration site family, member 10B; GalR1: galanin receptor 1; PKC : protein kinase C delta; Cyc-D: cyclin D; PPAR 2: peroxisome proliferator-activated receptor gamma; C/EBP : CCAAT/enhancer-binding protein, alpha; FAS: fatty acid synthase; CD36: fatty acid translocase; aP2: adipocyte protein2; TLR: Toll-like receptor; TNF : tumor necrosis factor alpha; IFN: interferon; MCP1: monocyte chemoattractant protein 1; IL-6: interleukin-6; GAPDH: gyceraldehyde-3-phosphate dehydrogenase.