Evidence-Based Complementary and Alternative Medicine / 2014 / Article / Tab 1 / Research Article
Caffeamide 36-13 Regulates the Antidiabetic and Hypolipidemic Signs of High-Fat-Fed Mice on Glucose Transporter 4, AMPK Phosphorylation, and Regulated Hepatic Glucose Production Table 1 Primers used in this study.
Gene Accession numbers Forward primer and reverse primer PCR product (bp) Annealing temperature (°C) Liver PEPCK NM_011044.2 F: CTACAACTTCGGCAAATACC 330 52 G6Pase NM_008061.3 F: GAACAACTAAAGCCTCTGAAAC 350 50 FAS NM_007988 F: TGGAAAGATAACTGGGTGAC 240 50 apo C-III NM_023114.3 F: CAGTTTTATCCCTAGAAGCA 349 47 Adiponectin NM_009605.4 F:TCTTCTACAACCAACAGAATCA 324 50.5 GAPDH NM_031144 F: TGTGTCCGTCGTGGATCTGA 99 55
