Evidence-Based Complementary and Alternative Medicine / 2014 / Article / Tab 2

Research Article

Transcriptome Profiling of Wheat Seedlings following Treatment with Ultrahigh Diluted Arsenic Trioxide

Table 2

Gene ID and respective forward and reverse primer nucleotide sequences (5′–3′) used for amplification by qRT-PCR. Functional categories of the genes are detailed in Table 1.

Gene ID Primer sequence 5′→3′

Wheat GAPDHTTGCTCTGAACGACCATTTC
GACACCATCCACATTTATTCTTC
BG909536TGCCTGGCGCTTGCA
CCAGTACGAGGACCAAATCGA
BJ270709TGCGGCTGGTTTCAAGTCA
CCCGGACGAGAGAAAACAAC
CK198840GGCCGGCTTACGCATGT
GGCCGTGGAGCTTACCATAA
CK207205CATGGTCGGTTGCCATCAG
TTCCCCAGTCAAGCTTTGGT
CK208220GTAGCTGTCGAAGAACACATGCTT
GCTCTGCGACACGAGGTACA
BQ838979GCCCGTACGTGCAGTACAAA
CGTAGGCCCGCATCTTGTAG
CA635455CCCGGCCTGGGAAGAA
TGGCTATGGCTTGGTTAGCA
CA660860CCTGCTCGTCTCCCAGGAT
GCGCAGGCATCGTTTCTT
BE416616TGCTCAAGATCTTCCTCGAGAAC
GGCGTGCTCGGTGTAGGT
BJ251672GCAAGACGCTTCCTCTTCGT
GTTGAAGCTTGTTCTTTTGCTTTG
BQ607338CTCCTCCACCTCGATCCAAA
CATGGCTGACGGCTTCCTT
CA628396AAGGGCTTGTTCGGCTAATTC
CAAACCAATCTTTGCCAATCC
CD868502TCCTCTTAGCCTGATGTGTTCATC
CGACCACGACACGAACAAAC
CD869995TCGCGACACCGCTTAGGT
CAGAATCCAACCAACCAAAGCT
CA719316CATCTTTAGCCATCCTCACAGAAA
TCTGTCAGATTCGTCGAGCAA
BJ225202GGCCGTCACCAAGTTCACA
CCGCCATCAATCCATGAAA
BJ262694TTGAAGTCCTGCGCGATCT
AAGAGCACGGAGCTGCTGAT
BJ274465TCACCCATGCTCGACGAA
TGAGATCCTGTATGTAATGCCTGCTA
BJ306445GGATCCCATCTTAGTCCATGAGA
GAGTAGCCGTCGTCCCCATA
BJ308450GCGCAGGACACAGAGTGAAA
CGGTGTACTGATGGTTCCAGTTT
BJ320258CAAGCTTGAGCACTCTCTGGAA
TCGTGTGCCTAGTGTCTGTGTTAA
BQ294672CATAGCCAGCGCACTAGATTCA
GGCTGACCCTGCTGTTTCC
BQ168973CCAGGGCAACACGAGCTT
TGCCAAACCCAATCCTAAGG
BJ322693GCCACCAGGAGAGCAAACAG
CGCTGCGGGTGATGAACT
CA613417TGCCCGTTCTGCAGCAA
CGTCCCGTGTCCACTGTCT
CA699507CGGCACCACCTACTCATGTG
CCATGGTCATTGGCGATAATC
CA708152CCAGAAGCAGCGCAACGT
GCGGTGCTTTTAGCCTTTAGG
CA708660AAGCACCAAAAGAAGGCACAA
TCTTGGTGTCATGGGAGAAATTT
CK205521GCCATCCCCGGTTCTTG
GCTGCCGATCGCTTATGTC
BF484849ACAGGTAACTGGGAGGGCAAT
AGATCTGAATTATGTGATGGGCATT
BJ226504CTTCACCCTGCCCAAGGA
CCGCTGTTGCTGATCACAAA
BJ246114GGCAGGCACACGAACGA
GCGAGGGCTCTAGGTTACAACA
BJ303391GCTGAAGAACCCGGAATCG
TCCTCCTGGAATGCTGCAA
BJ312841CGCATGACAGGAGAGCGTTT
TGTCCCACTGACAGCAACAGTT
BQ578355CCATCGCCTTCTACATCAAGGT
GCGACGAGCTTCTCGATCTC
CA629836TTGCACACCCTTCGACAAAG
TTTGCTGCTTGCTCTTGAAAAA
CA640553AACCCATGCGTCACCTGATC
CCTACCTTCCATGAGCTCAACTG
CA681335CTGGGAGTGCTGGTTGCAT
TGGCATGATAGGCTTCCTTGA
CA744534CACGGATCTGGGACCTGAA
CCAGCGTGCCCTTCTAGCT
CA747224CAGAGCAAACCCAACTCGAATA
CTTCTAGCCGCCATTTGGAA
CD453390TCCGCGCTTGTTCAAGTACTC
TTGGGTGCTGCCTTCCA
CK203324TCTGAGCCCGGCACCAT
TGACGTTCCTGCCGATGTC
CK210556AGAAGATGCGTGCGGTTCTC
GTTCGGCCTCACCATTGG
BJ228692GGCCTTCTTGGCCATCCTTA
CTTGCCCGGGAGATAAATCA
BJ243882CAGGAAGCAGATCGCTGTTG
AGGATGGCTACGTTCTGGTTTC
BJ256146GGATAGGGCAGCTGCTTTCA
GGCTTGACAGCCACCTTAGG
CA599873CATGAGGACACCATGAGCAAA
ACCAGCATCCAGAATACCAGAAG
CA700404ACTACCGCCTCCCCAACAC
CCGCGACTCGAAGAAGAAGT
CA731980AGCGGCAGCTACGTGAACTT
TGGGCTCCTCCACCATGA
CA642191GGTAGAGAGGATCGCTGAAATCA
GCCGCCAGCTTAGGAACTT
CA676257TGGCAAACGCCGAGTACA
GCGCCCAGTTGAAGCAGTA
CA676553TTACCCCGCCAAAAAATGTATT
ACGGCTGCCTGCACATCT
CA685752GCTGGAGAGACCGTTTTGTCTT
CGGTTTCGGCCTGTGATTTA
CA719198CACCGCCAGAGGGTCTTTC
CGCACTGCTCGATGATATGC
CK198851GCCGGGCCCTTACGAAT
CCTTCAAGGTGGCAACAGGTT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.