Table 1: Primer sequences used for Q-PCR.

Gene namePrimer sequencesProduct length

Bcl-2-F5′-GGGACGCGAAGTGCTATTGGT-3′208 bp
Bcl-2-R5′-CTCAGGCTGGAAGGAGAAGAT-3′208 bp
Bax-F5′-GTTTCATCCAGGATCGAGCAGA-3′265 bp
Bax-R5′-GCAAAGTAGAAGAGGGCAACCAC-3′265 bp
β-actin-F5′ AGGGAAATCGTGCGTGACAT150 p
β-actin-R5′ GAACCGCTCATTGCCGATAG150 p