Evidence-Based Complementary and Alternative Medicine / 2016 / Article / Tab 1

Research Article

Pinoresinol Diglucoside Alleviates oxLDL-Induced Dysfunction in Human Umbilical Vein Endothelial Cells

Table 1

PCR primer sequence.

PrimerSequence

GAPDH_FCCACTAGGCGCTCACTGTTC
GAPDH_RAGGCGCCCAATACGACCAA
hNF-kB_FGCAGATGGCCCATACCTTCA
hNF-kB_RTAGAGGCACCAGGTAGTCCA
hICAM1_FCCCCTCAAAAGTCATCCTGC
hICAM1_RGGGTCTCTATGCCCAACAACT
hLox-1-FCTGACCTCCTAACACAAG
hLox-1-RTGAAGTCCAGATCAGCTC
heNOS-FGATGAGTATGACGTGGTGTCCC
heNOS-RCCGAGGGGAGCTGTTGTA

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.