Table 1: Primers used for quantitative RT-PCR.

GenesForward (5′–3′)Reverse (5′–3′)

GAPDHAGGAGCGAGACCCCACTAACA AGGGGGGCTAAGCAGTTGGT
IL-3GCCTGCCTACATCTGCGAATGGTTAGGAGAGACGGAGCCA
IL-6GTCCGGAGAGGAGACTTCACCTGCAAGTGCATCATCGTTGT
GM-CSFTTACTTTTCCTGGGCATTGTGGCAGGAGGTTCAGGGCTTCTTTG
TNF-αACCCTCACACTCACAAACCAATAGCAAATCGGCTGACGGT
G-CSFCGCATGAAGCTAATGGGTGAGTGACGGGTCTGAGGCACTTGTT