Table 1: The sequence of primers used in RT-PCR.

PrimerSequence(s) 5′-3′

β-actin
 ForwardTCCCTGGAGAAGAGCTACG
 Reverse GTAGTTTCGTGGATGCCACA
M caspase-3 (Mus musculus caspase-3)
 ForwardTGTCATCTCGCTCTGGTACG
 Reverse AAATGACCCCTTCATCACCA
Bcl-2 (human and mouse Bcl-2)
 ForwardCCTGGGATGACTGAGTACC
 Reverse GAGACAGCCAGGAGAAATCA
H caspase-3 (human caspase-3)
 ForwardATGGTTTGAGCCTGAGCAGA
 Reverse GGCAGCATCATCCACACATAC
M GAPDH (Mus musculus glyceraldehyde-3-phosphate dehydrogenase)
 ForwardCCTCGTCCCGTAGACAAAA
 Reverse AATCTCCACTTTGCCACTG