Table 2: Primers for rat genes used in real-time PCR.

GeneForward primer (5′→3′)Reverse primers (5′→3′)Length of product (bp)

β-ActinACCCGCGAGTACAACCTTCTTTCAGGGTCAGGATGCCTCT266 bp
Wnt4AGCCCACAGGGTTTCCAGCTCGCCAGCATGTCTTT233 bp
GSK-3βGTCCGATTGCGGTATTGTGTCTGGCGACTCTGTA108 bp
β-CateninAACGGCTTTCGGTTGAGCTGTGGCGATATCCAAGGGCTTC147 bp
E-CadherinTGCTCCTACTGTTTCTACGCTTCTCCACCTCCCTCTT111 bp
ILKAATGGGACCCTGAACAAAGAGCCTGGCAAGCACCTA244 bp
TGF-β1ATGGTGGACCGCAACAACTGAGCACTGAAGCGAAAGC329 bp