Evidence-Based Complementary and Alternative Medicine / 2017 / Article / Tab 1

Research Article

Effect of Seyoeum on Obesity, Insulin Resistance, and Nonalcoholic Fatty Liver Disease of High-Fat Diet-Fed C57BL/6 Mice

Table 1

Primer sequences.

TargetPrimerSequence (5′-3′)

TNF-αFTTCTGTCTACTGAACTTCGGGGTGATCGGTCC
RGTATGAGATAGCAAATCGGCTGACGGTGTGGG
IFN-γFACTGGCAAAAGGATGGTGAC
RTGAGCTCATTGAATGCTTGG
IL-6FAACGATGATGCACTTGCAGA
RGAGCATTGGAAATTGGGGTA
MCP-1FCCCACTCACCTGCTGCTACT
RTCTGGACCCATTCCTTCTTG
Cxcl3FAGGCTACAGGGGCTGTTGT
RGGGTTGAGGCAAACTTCTTG
IRFGAGATGGTCCACCTGAAGGA
RGGACAGACATCCCCACATTC
IRS-1FAAGCACCTGGTGGCTCTCTA
RTCAGGATAACCTGCCAGACC
IRS-2FATACCGCCTATGCCTGTCTG
RTGGTCTCATGGATGTTCTGC
GAPDHFAGTCCATGCCATCACTGCCACC
RCCAGTGAGCTTCCCGTTCAGC

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.