Electroacupuncture Reduces Weight in Diet-Induced Obese Rats via Hypothalamic Tsc1 Promoter Demethylation and Inhibition of the Activity of mTORC1 Signaling Pathway

Table 2

Primer used in RT-PCR.

Gene	Forward primer	Reverse primer	Product size (bp)
mTORC1	agaggaccagcagcacaagcagga	tggtggcagtggtggtggcatt	299
AgRP	agacagcagcagaccgagcagaaga	gccagtacctagcttgcggcagtag	218
NPY	cgtgtgtttgggcattctggctgag	tggtgggacaggcagactggtttca	325
PoMC	tgatggcttggagcacgtcctggag	gcgtctggctcttctcggaggtcat	137
β-Actin	gaagatcaagatcattgctcct	tactcctgcttgctgatcca	111