Evidence-Based Complementary and Alternative Medicine / 2018 / Article / Tab 1

Research Article

Flavanones from Sedum sarmentosum Bunge Alleviate CCl4-Induced Liver Fibrosis in Rats by Targeting TGF-β1/TβR/Smad Pathway In Turn Inhibiting Epithelial Mesenchymal Transition

Table 1

Primers used for the qRT-PCR study.

GeneForward primer (5′-3′)Reverse primer (5′-3′)

TβRIGATACAAGGGAGTCAAGTTGAGATAGGTCATGGCTAA
TβRIIGAGTGAAGCCGTGGTAGGTTGAGAAGCCGCAGGAAGT
TGF-β1CTGCTGACCCCCACTGATACTGTATTCCGTCTCCTTGGTCC
Smad2TACCACTCTCTCCCCTGTCAATGCAAACCTAAGCAGAACCTCTC
Smad3TGGCTACCTGAGTGAAGATGGAGTTATTGTGTGCTGGGGACA
Smad7GATACCCGATGGATTTTCTCAAAGGGCTCTTGGACACAGTAGAG
E-CadherinTTTGGAAGCTTTGGCTGAGTGTTGGCCAGTCACCTGAAAT
VimentinAAGCAGGAGTCCACTGAGTAGTATCAACCA GAGGGAGTGA
GAPHDGGCACAGTCAAGGCTGAGAATGATGGTGGTGAAGACGCCAGTA