Evidence-Based Complementary and Alternative Medicine / 2018 / Article / Tab 1

Research Article

Erchen Decoction Ameliorates Lipid Metabolism by the Regulation of the Protein CAV-1 and the Receptors VLDLR, LDLR, ABCA1, and SRB1 in a High-Fat Diet Rat Model

Table 1

Primer sequences used for real-time PCR analysis.

GeneForward primerReverse primer

CAV-1TAAACCCATTCCTGCTCTCCCGCCTCCCAGTCTTCCTATT
VLDLRCACCAAAGTATGTGACCAGGAAAACAGCCACCGTTATTGACC
LDLRTAGGGTTTCTGCTCTTCACCAGCCACCACATTCTTCAGGTT
SRB1GGACAAGCAGTTCCAGATCCGCCAATTCAGTGTTCAGGTG
ABCA1TGCTTCCGTTATCCAACTCCTCCCTAATGCTGGTGTCCTT
β-ActinCACCCGCGAGTACAACCTTCCCCATACCCACCATCACACC