Evidence-Based Complementary and Alternative Medicine / 2019 / Article / Tab 2

Research Article

Shengjing Capsule Improves Spermatogenesis through Upregulating Integrin α6/β1 in the NOA Rats

Table 2

Primers used for detection of the mRNA expression by RT-PCR.

GeneSequences
ForwardReverse

GAPDHAGGTCGGTGTGAACGGATTTGGGGGTCGTTGATGGCAACA
ITGA6GTTGTGCTTGCTCTACCTGTCCGCGAGCGAGAAGCCGAAGAG
ITGB1GAATGGAGTGAATGGGACAGGAGCAGATGAACTGAAGGACCACCTC
DND1CTCCCTCTTAGCTTGAACCGACGACTCCACAGCCACCTGCTCT

ITGA6 = α6-integrin; ITGB1 = β1-integrin.