Evidence-Based Complementary and Alternative Medicine / 2019 / Article / Tab 3

Research Article

Effect of Tripterygium wilfordii Polycoride on the NOXs-ROS-NLRP3 Inflammasome Signaling Pathway in Mice with Ulcerative Colitis

Table 3

The sequences of the RT-PCR primers.

NameGenBank accessionPrimer sequences (5′-3′)Size (bp)Annealing (°C)

Rat NLRP3NM_001191642.1AAGCAGCAGATGGAGACTGGAAA TGAACAGAGCCCTGGCAGGTAG14963
Rat caspase-1NM_012762.2TGAACAAAGAAGGTGGCGCATT GGCAAGACGTGTACGAGTGGGT14063
Mouse ASCNM_023258.4GGTCACAGAAGTGGACGGAGTG CATCTTGTCTTGGCTGGTGGTCT10363
Mouse 18sNR_003278CGGACACGGACAGGATTGACA CCAGACAAATCGCTCCACCAACTA9463

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.