Evidence-Based Complementary and Alternative Medicine / 2021 / Article / Tab 2

Research Article

Study on the Expression Differences and the Correlation with H2BE Gene of Th Related Cytokines in SSDHS and LDSDS TCM-Syndromes of CHB Patients

Table 2

The primer pairs for qRT-PCR validation.

PrimersSequence (5’-3’)

H2BE-Fagtggctgagttcggctgtc
H2BE-Rgctgccaagcgtcagtcata
U6b-Fggcagtcgaccgacgaata
U6b-Rcgtgaaagaccgcagcaa