Evidence-Based Complementary and Alternative Medicine / 2021 / Article / Tab 1 / Research Article
Efficacy of Ethanolic Extract of Syzygium aromaticum in the Treatment of Multidrug-Resistant Pseudomonas aeruginosa Clinical Isolates Associated with Urinary Tract Infections Table 1 Target genes, primers, sequences, cycling conditions, and amplicon sizes. All specific sequences were amplified in this experiment (Metabion, Germany). A 16Sr DNA gene of P. aeruginosa was also examined.
Target gene Sequence Amplified product (bp) Primary denaturation Amplifications (35 cycles) References Secondary denaturation Annealing Extension Final extension P. aeruginosa 16Sr DNAGGGGGATCTTCGGACCTCA 956 94°C/5 min 94°C/30 sec 52°C/45 sec 72°C/1 min 72°C/10 min [24 ] Antibiotic-resistant genes bla TEM ATCAGCAATAAACCAGC 516 94°C/5 min 94°C/30 sec 54°C/45 sec 72°C/45 sec 72°C/10 min [25 ] bla SHV AGGATTGACTGCCTTTTTG 392 94°C/5 min 94°C/30 sec 54°C/45 sec 72°C/45 sec 72°C/10 min [25 ] bla CTX ATGTGCAGYACCAGTAARTKATGGC 593 94°C/5 min 94°C/30 sec 54°C/40 sec 72°C/45 sec 72°C/10 min [26 ] Virulence genes toxA GACAACGCCCTCAGCATCACCAGC 396 94°C/5 min 94°C/30 sec 55°C/40 sec 72°C/40 sec 72°C/10 min [27 ] lasB ACAGGTAGAACGCACGGTTG 1220 94°C/5 min 94°C/30 sec 54°C/40 sec 72°C/1 min 72°C/12 min [28 ] pslA TCCCTACCTCAGCAGCAAGC 656 94°C/5 min 94°C/30 sec 60°C/40 sec 72°C/45 sec 72°C/10 min [29 ] fliC TGAACGTGGCTACCAAGAACG 180 94°C/5 min 94°C/30 sec 56.2°C/30 sec 72°C/30 sec 72°C/7 min [29 ]
