Evidence-Based Complementary and Alternative Medicine / 2021 / Article / Tab 1

Research Article

Standardized Extract (HemoHIM) Protects against Scopolamine-Induced Amnesia in a Murine Model

Table 1

Primer sequences used for reverse transcriptase PCR.

GeneDirectionSequence (5′ to 3′)

AchEForwardAGAAAATATTGCAGCCTTTG
ReverseCTGCAGGTCTTGAAAATCTC
ChATForwardAGGGTGATCTGTTCACTCAG
ReverseTCTTGTTGCCTGTCATCATA
M1 AchRForwardCAGAAGTGGAGATGCC
ReverseGAGCTTTTGGGAGGCTGCTT
M2 AchRForwardTGCTGTGGCCTCCAATATGA
ReverseTGACCCGACGACCCAACT
BDNFForwardAGCTGAGCGTGTGTGACAGTAT
ReverseCCGAACATACGATTGGGTAGTT
Trk βForwardGCACATCGCTCAGCAAATCG
ReverseACAACTCCCAGGCTCCAGAC
CREBForwardCCCAGGGAGGAGCAATACAG
ReverseGGGAGGACGCCATAACAACT
ERK1ForwardACCGTGACCTCAAGCCTTCC
ReverseGATGCAGCCCACAGACCAAA
ERK2ForwardTTGCTGAAGCACCATTCAAG
ReverseACGGCTCAAAGGAGTCAAGA
β-actinForwardGCCATGTACGTAGCCATCCA
ReverseGAACCGCTCATTGCCGATAG

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.