Evidence-Based Complementary and Alternative Medicine / 2021 / Article / Tab 2

Research Article

PAMK Relieves LPS-Induced Enteritis and Improves Intestinal Flora Disorder in Goslings

Table 2

The primers and amplification parameters of target genes.

GenePrimer sequence (5′ to 3′)

TLR4F: TTGTGTGCTGAAGGTCCAAGR: TCCTCAGTTTCCTGGGTCTG
OccludinF: TCTTCCACATCAAGCGCATGR: GGTCGCTTTGGATGTTGGTT
ZO-1F: CAAAGGTGAAGTGTTCCGGGR: CTCCTCCTGCTGTCTTTGGA
IL-1βF: ACGGTGTGGGGACATTCATCR: AGGCGAAGCTTCTTCTGTGG
IL-2F: TCATCTCGAGCTCTACACACCAAR: TGCATTCACTTCCGGTGTGAT
IL-4F: GGCATCTACCTCAACTTGCTR: CTCTTTCGCTACTCGTTGGA
IL-6F: ACGATAAGGCAGATGGTGATR: TCCAGGTCTTATCCGACTTC
IL-10F: ATCATGACATGGACCCGGTAR: ATTGCTCCATGACAGTTGCT
IFN-γF: CCAGATTGTTTCCCTGTACTTGR: CATCAGAAAGGGTGTCTCTCA
TGF-βF: CATCACAGAGACAGGAACCTTR: CTTTCACATCACCACTGGAA
IgAF: GTCACCGTCACCTGGACTACAR: ACCGATGGTCTCCTTCACATC
IgGF: ATCACGTCAAGGGATGCCCGR: ACCAGGCACCTCAGTTTGG
IgMF: GCATCAGCGTCACCGAAAGCR: TCCGCACTCCATCCTCTTGC
β-ActinF: GCACCCAGCACGATGAAAATR: GACAATGGAGGGTCCGGATT