Gastroenterology Research and Practice / 2013 / Article / Tab 2

Research Article

Dominant Fecal Microbiota in Newly Diagnosed Untreated Inflammatory Bowel Disease Patients

Table 2

Sequence of the probes used in the project.

ProbeSequence

Probe 3-Escherichia/Shigella GCCTCAAGGGCACAAC
Probe 6-Dialister AAGAACTCCGCATTTCTGC
Probe 8-Faecalibacterium CGTAGTTAGCCGTCACTTC
Probe 13-Haemophilus TCGCTTCCCTCTGTATACG
Probe 16-Enterococcus CCCTCCAACACTTAGCA
Probe 18-Lactobacillus CCTGTTTGCTACCCATACTTT
Universal probeCGTATTACCGCGGCTGCTGGCA