Gastroenterology Research and Practice / 2014 / Article / Tab 1

Research Article

The CIMP Phenotype in BRAF Mutant Serrated Polyps from a Prospective Colonoscopy Patient Cohort

Table 1

Primers and probes for methylation, BRAF, and KRAS mutation analysis.

Gene Primers

ALU FP: GGTTAGGTATAGTGGTTTATATTTGTAATTT
RP: ATTAACTAAACTAATCTTAAACTCCTAACCT
Probe: 6FAM-CCTACCTTAACCTCCC-MGBNFQ

IGF2 FP: GAGCGGTTTCGGTGTCGTTA
RP: CCAACTCGATTTAAACCGACG
Probe: 6FAM-CCCTCTACCGTCGCGAACCCGA-BHQ-1

SOCS1 FP: GCGTCGAGTTCGTGGGTATTT
RP: CCGAAACCATCTTCACGCTAA
Probe: 6FAM-ACAATTCCGCTAACGACTATCGCGCA-BHQ-1

NEUROG1 FP: CGTGTAGCGTTCGGGTATTTGTA
RP: CGATAATTACGAACACACTCCGAAT
Probe: 6FAM-CGATAACGACCTCCCGCGAACATAAA-BHQ-1

RUNX3 FP: CGTTCGATGGTGGACGTGT
RP: GACGAACAACGTCTTATTACAACGC
Probe: 6FAM-CGCACGAACTCGCCTACGTAATCCG-BHQ-1

CACNA1G FP: TTTTTTCGTTTCGCGTTTAGGT
RP: CTCGAAACGACTTCGCCG
Probe: 6FAM-AAATAACGCCGAATCCGACAACCGA-BHQ-1

MLH1 FP: AGGAAGAGCGGATAGCGATTT
RP: TCTTCGTCCCTCCCTAAAACG
Probe: 6FAM-CCCGCTACCTAAAAAAATATACGCTTACGCG-BHQ-1

p16 FP: TGGAGTTTTCGGTTGATTGGTT
RP: AACAACGCCCGCACCTCCT
Probe: 6FAM-ACCCGACCCCGAACCGCG-BHQ-1

IGFBP7 FP: GGTAAAGTCGGGGTAGTAGTCG
RP: ACAACCGCTCGAATAAATAATACCG
Probe: 6FAM-CGCTACCGCACACCGAATAACGACTCTTA-BHQ-1

BRAF V: GTGATTTTGGTCTAGCTACtGT
E: CGCGGCCGGCCGCGGCGGTGATTTTGGTCTAGCTACcGA
AS: TAGCCTCAATTCTTACCATCCAC

KRAS 189-bpFP: TCATTATTTTTATTATAAGGCCTGCTGAA
RP: CAAAGACTGGTCCTGCACCAGTA

KRAS 92-bpFP: ttataagGCCTGCTGAAAATGACTGAA
RP: TGAATTAGCTGTATCGTCAAGGCACT