Table 1: Primers for qPCR.

BacteriumPrimer sequence (5->3)Size (bp)

Prevotella speciesF: CACCAAGGCGACGATCA283
R: GGATAACGCCCGGACCT
Bacteroides coliF: ATAGCCTTTCGAAAGAAAGAT494
R: CCAGTATCAACTGCAATTTTA
Bifidobacterium speciesF: GGGTGGTAATGCCGGATG438
R: TAAGCGATGGACTTTCACACC
Lactobacillus speciesF: AGCAGTAGGGAATCTTCCA341
R:CACCGCTACACATGGAG