Investigating Rice Blast Resistance Gene Distribution among Landrace Rice Varieties in Lower Northern Thailand for Improving Rice Cultivars

Urtgam, Sittichai; Sujipuli, Kawee; Suyasunanont, Urasri; Rattanachak, Nontaporn; Jongjitwimol, Jirapas; Jongjitvimol, Touchkanin

doi:https://doi.org/10.1155/2023/6464153

International Journal of Agronomy

On this page

Abstract Introduction Materials and Methods Results and Discussion Conclusions Data Availability Conflicts of Interest Authors’ Contributions Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2023 | Article ID 6464153 | https://doi.org/10.1155/2023/6464153

Investigating Rice Blast Resistance Gene Distribution among Landrace Rice Varieties in Lower Northern Thailand for Improving Rice Cultivars

Sittichai Urtgam,¹Kawee Sujipuli,²Urasri Suyasunanont,³Nontaporn Rattanachak,¹Jirapas Jongjitwimol,^4,5and Touchkanin Jongjitvimol¹

Academic Editor: Francesca Degola

Received01 Mar 2023

Revised24 Apr 2023

Accepted21 Jun 2023

Published01 Jul 2023

Abstract

Rice blast disease caused by the fungus Pyricularia oryzae is considered as one of the severe diseases, leading to reduce tremendous rice productivity in its cultivated areas of Thailand. Due to the rapid evolution and high genetic diversity of the pathogen, the innate rice resistance (R) genes associated with defense mechanisms are significantly considered as the most important for rice breeding program to create new rice varieties, resistant to blast disease. This study aimed to investigate the rice blast R genes (Pi9, Pib, and Pi-ta) in 98 landrace rice germplasms collected from three different provinces in lower northern Thailand, Phichit (PCT), Phitsanulok (PLK), and Sukhothai (STI) through PCR assay. The results showed that the Pi-ta gene was presented in 29 different varieties, making it the most widespread, whereas the Pi9 and Pib genes were found in 28 and 25 varieties, respectively. The distribution percentage of studied genes in PLK and STI germplasms is higher than in PCT germplasms. Interestingly, only eight landrace rice varieties (varieties no. 46, 47, 48, 51, 66, 76, 81, and 90) collected from PLK and STI germplasms contain all of these three resistance genes. This finding provided the genetic information and diversity of the R genes across landrace rice varieties in the lower north of Thailand. Moreover, these R genes could be useful as genetic resources for rice improvement with resistance to blast disease through breeding program in the future.

1. Introduction

Pyricularia oryzae (Ascomycota, syn. Magnaporthe oryzae) [1] is one of the major fungal pathogens causing rice blast disease (RBD) worldwide [2]. Symptomatic RBD is appeared in many parts of rice seedlings (Oryza sativa L.), such as leaf, stem, and node, resulting in a severe reduction of growth development and yield of rice [3]. Generally, the RBD management in rice field could be controlled by using antifungal agents such as azoxystrobin and tricyclazole [4]. However, the application of these agents has been still an ineffective strategy and leads to the environmental pollution [5]. Notwithstanding, the pathogenic Pyricularia is highly divergent in genetic patterns [6], causing the rapid outbreak and transmission in rice cultivation areas to other adjacent areas. To prevent outbreak and transmission of pathogenic Pyricularia in rice for long-term control of RBD, the rice varieties with RBD resistance would be an effective strategy for long-term control of this disease [7].

Three major resistance (R) genes associated with RBD were known as Pia, Pii, and Pik. Over the past decade, more than 100 R genes had been identified across rice chromosomes, except for chromosome 3 [8, 9]. Of these, the R genes were categorized into 5 groups based on their encoding proteins: (1) nucleotide-binding site leucine-rich repeat (NBS-LRR), e.g., Pib located on chromosome 2, Pi9 located on chromosome 6, Pi-ta located on chromosome 12; (2) coiled-coil-nucleotide-binding site leucine-rich repeat (CC-NBS-LRR), e.g., Pit located on chromosome 1, Pi25 located on chromosome 6, Pia located on chromosome 11; (3) proline-rich metal binding protein, e.g., pi21 located on chromosome 4; (4) B-lectin receptor kinase, e.g., Pi-d2 located on chromosome 6; and (5) atypical protein with an armadillo repeat, e.g., Ptr located on chromosome 12 [9].

The rice blast resistance gene is involved in plant cell defense mechanisms against the fungal pathogen invasion. There are five main functions of the R genes occurred via their encoding proteins. For example, the rice blast resistance Pi9 gene encodes the NBS-LRR protein [9] which is involved in upregulating the transcriptional activation of kinases, JA-ET hormones, chitinases, glycosyl hydrolases, lipid biosynthesis, pathogenesis, and secondary metabolism-related genes to trigger the cell signaling pathway for preventing the infection [10]. Rice blast resistance Pi-ta gene encoded a protein, cytoplasmic membrane receptor protein containing NBS-LRR domains [11], functioning via the direct interaction of the LRR domain to another protein, neutral zinc metalloprotease encoded by an avirulent-Pi-ta (AVR-Pi-ta) [12], and then triggering the resistance pathway to respond to the blast fungal infection [13].

The previous study demonstrated that biomarkers could provide the efficiency to investigate the blast resistance gene using the specific DNA marker to the R genes. The specific primers corresponding to R genes were designed, e.g., Pi9, Pib, Pi-ta. The rice blast resistance Pi9 gene confers to resist more than 43 isolates of rice blast fungal samples collected from 13 countries, and the DNA marker of Pi9 was designed based on the sequence of the gene located 2.8cM from RFLP marker RG64 on chromosome 6 [14]. The specific primers of Pi9 were pB8-F (5′ CCCAATCTCCAATGACCCATAAC 3′) and pB8-R (5′ CCGGACTAAGTACTGGCTTCGATA 3′) for detecting the resistant allele of the Pi9 gene [15] with the sample of its resistance allele sequence presented in GenBank accession MZ327711. The Pib primers were developed based on the sequence of the cloned Pib blast resistance gene [16] with Pibdom marker (PibdomF; 5′ GAACAATGCCCAAACTTGAGA 3′ and PibdomR; 5′ GGGTCCACATGTCAGTGAGC 3′) corresponding to bases 8699-9063 in GenBank accession AB013448 and to specifically amplify a particular fragment of the Pib gene [17]. The rice blast resistance Pi-ta gene was found as resistant and susceptible alleles with the difference as only one nucleotide, and thus, the specific primer of the resistant allele was developed to locate the middle region of Pi-ta gene. DNA primers YL155/YL87 (F; 5′ AGCAGGTTATAAGCTAGGCC 3′ and R; 5′ CTACCAACAAGTTCATCAAA 3′) were designed and showed the specific amplification only the resistant allele corresponding to bases 4409-5450 in GenBank accession no. AF207842 [18].

In Thailand, landrace rice is the most important resource of genetic diversity containing responsive genes to abiotic and biotic stress [7, 19]. More recently, rice blast resistance genes were characterized in landrace rice from various locations such as Bangladesh, China, Japan, Malaysia, Thailand, and Vietnam. From these, more than 30 R genes were identified in Asian landrace rice, i.e., Pi-36, Pi9, Pib, Pigm(t), Pik-p, Pik-h, Pi-ta, Piz [7, 20–23]. Of these 30 R genes, the Pi9, Pib, and Pi-ta were commonly found in resistance rice cultivars grown in Malaysia [20] and Thailand [7].

Lower northern Thailand is one of the most important main areas for rice production. In 2021, farmers from the three provinces including Phichit, Phitsanulok, and Sukhothai could produce the high yields of rice production by 216.4–248.0 kg/acre [24]. However, rice blast disease outbreaks and causes rice yield losses in the areas. Due to the fungal infection, there were from 10% to 30% of rice harvest losses each year [25], posing a serious danger to Thailand and global rice production, including economic value. Therefore, this study aimed to investigate the profiles of three RBD-resistance genes (Pi9, Pib, and Pi-ta) among landrace rice provided by lower northern Thailand germplasms, located in Phichit, Phitsanulok, and Sukhothai provinces. The findings could identify the rice blast resistance genes in Thai landrace rice and could be essential benefits for rice improvement against blast resistance disease through the crossbreeding program.

2. Materials and Methods

2.1. Plant Materials

Ninety-eight varieties of landrace rice (Table 1) were provided by germplasm of the Phitsanulok Rice Research Center, collected from the three different provinces of Phichit (PCT), Phitsanulok (PLK), and Sukhothai (STI) (Figure 1). The rice seeds were placed on tissue soaking with sterilized water for 7 days, and then, young seedlings were transferred into a pot containing soil for 7–14 days.

2.2. Genomic DNA Extraction

The young leaf was washed with distilled water prior to genomic DNA extraction using the acetyl trimethyl ammonium bromide (CTAB) method according to slightly modified by Doyle and Doyle [26]. Briefly, young rice leaf (1 g) was individually ground into powder in liquid nitrogen and transferred into lysis buffer containing 2% CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM ethylene diamine tetra-acetic acid (EDTA), 1% polyvinylpyrrolidone (PVP), and 1% sodium dodecyl sulfate (SDS). The mixture was gently homogenized and incubated at 65°C for 30 min. After centrifugation at 12,000 rpm for 10 min, the upper phase was transferred to a new tube, and then, an equivalent volume of chloroform : isoamyl alcohol (24 : 1) was added. The mixture was stored at room temperature for 5–10 min and then centrifuged at 12,000 rpm for 10 min. The supernatant solution was collected for DNA precipitation by adding 2 volumes of isopropanol and then incubated at −20°C overnight. The genomic DNA (gDNA) was precipitated by centrifuging at 12,000 rpm for 10 min and washed twice with 70% ethanol. The pellet was air-dried at room temperature for 5–10 min. The gDNA was dissolved in 1x TE buffer, and RNA contamination was eliminated by adding 50 µg/ml RNase A (1 µl) and incubated at 65°C for 30 min. The quality, quantity, and integrity of the gDNA sample were determined in a 1% TBE agarose gel electrophoresis system, strained with 1x SYBR Safe DNA gel stain (Invitrogen, USA), and visualized and photographed under UV light with a gel documentation system (Bio-Rad, USA).

2.3. Detection of Blast Resistance Genes in Rice

The gDNA samples (50–80 ng) were used as templates for the detection of blast resistance gene amplification using the polymerase chain reaction (PCR) method [27] with gene-specific primers (Table 2). A PCR reaction (25 µl) was performed by 2.5 µl of 10x Taq buffer, 3 mM MgCl₂, 1 unit of Taq DNA polymerase (Invitrogen, USA), and 200 nM of each dNTP, 200 µM of individual gene-specific primer pair of Pi9, Pib, and Pi-ta (listed in Table 2). The PCR amplification was carried out in T100™ Thermal Cycle (Bio-Rad, USA) under an optimal condition: predenaturation 1 cycle at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 45 seconds, annealing at an optimal temperature of each gene for 45 seconds and extension at 72°C for 90 seconds, and final extension for 1 cycle of 72°C for 5 min. The PCR product was analyzed on 2.5% TBE agarose gel electrophoresis together with 100 bp DNA ladder (GeneDireX, Taiwan), containing 1x SYBR Safe DNA gel stain (Invitrogen, USA), and visualized under UV light with Gel documentation system (Bio-Rad, USA). The rice actin gene, a housekeeping gene, was used as a reference gene to determine the PCR amplification using a gene-specific primer (ACT-F; 5′ ATGAAGATCAAGGTGGTCGC 3′ and ACT-R; 5′ GTACTCAGCCTTGGCAATCC 3′) with the appropriated condition [28].

2.4. Data Analysis

The amplicon of actin gene with 200 bp long was indicated for the reference gene in each landrace rice varieties prior to the R gene determination. The presence of amplicon size on gel, corresponding to 466, 365, or 1,042 bp long, was indicated for the specific profile of target gene either Pi9, Pib, or Pi-ta, respectively, across studied rice varieties. All experiments were performed as triplicates. The data analysis was performed using the SPSS statistics program (Version 17.0; SPSS Inc., Chicago). Descriptive statistics, e.g., frequency and percentage, was used to describe the distribution of each R gene in different landrace rice.

3. Results and Discussion

3.1. Distribution of Resistance Genes among Rice Varieties

The presence of selected blast resistance genes (Pi9, Pib, and Pi-ta) was examined in 98 landrace rice varieties (listed in Table 1), using PCR assay with the gene-specific primers. The amplicons of the reference gene, actin gene, were determined in all of 98 landrace rice varieties with 200 bp long (Figure 2). The Pi9, Pib, or Pi-ta primer enabled to generate PCR amplicon size, corresponding to approximately 466 (Figure 3), 365 (Figure 4), and 1,042 bp long (Figure 5), respectively, according to previous works reported by Liu et al. [15], Fjellstrom et al. [17], and Jia et al. [18]. Among the landrace rice varieties studied, the examined genes displayed slightly different distribution. The Pi-ta gene was identified in the highest proportion from 29 varieties, accounting for 29.59%. The Pi9 gene was found in 28 varieties or 28.57%. In contrast, the Pib gene exhibited the lowest occurrence, representing 25.51% across 25 varieties (Figure 6).

(a)

(b)

(c)

(a)

(b)

(c)

(a)

(b)

(c)

(a)

(b)

(c)

Figure 6

Number of rice blast resistance genes (Pi9, Pi-ta, and Pib gene) presented in individual landrace rice varieties of Phichit (PCT), Phitsanulok (PLK), and Sukhothai (STI). Note: The presence of the Pi9, Pib, and Pi-ta genes in rice verities is related to PCR amplicons in Figures 1–3, respectively. The Pi9 presents in landrace rice varieties no. 04, 23, 27, 35, 37, 38, 42, 43, 45, 46, 47, 48, 51, 52, 58, 62, 63, 66, 76, 77, 79, 81, 82, 83, 84, 85, 86, and 90 with a total of 28 (28.57%) varieties. The Pib presents in landrace rice varieties no. 06, 15, 21, 26, 28, 46, 47, 48, 50, 51, 53, 66, 67, 70, 72, 73, 74, 76, 78, 81, 86, 87, 89, 92, and 98 with a total of 25 (25.51%) varieties. The Pi-ta presents in landrace rice varieties no. 05, 09, 17, 18, 20, 26, 28, 33, 46, 47, 48, 50, 51, 53, 66, 71, 72, 73, 74, 75, 76, 77, 81, 85, 87, 88, 89, 90, and 92 with a total of 29 (29.59%) varieties.

The distribution of the resistance genes across studied rice varieties was explored that Pi9 gene gave highest in STI germplasms (45.00%), followed by PLK germplasms (31.43%), and 18.60% in PCT germplasms, respectively. The findings in this study correlated with the other studies on landrace rice. The previous study reported that almost all Thai landrace rice carried at least one R gene, and more than 80% carried at least three or more R genes. Especially, the Pid3 is the most frequently R gene found in rice. The Pi9 is one of the major R gene found in international rice [29]. In addition, the Pi9 distribution was various in the different locations of Thailand which is the highest frequency in the north-eastern of Thailand compared to the other parts [30, 31].

Recently, a previous study had been reported that the Pi9 gene located on chromosome 6, encoding the nucleotide-binding site and leucine-rich repeat (NBS-LRR) protein [9]. It plays an important role for upregulated genes involved in the transcriptional activation of kinases (e.g., WRKY, MYB, ERF transcription factors), JA-ET hormones, chitinases, glycosyl hydrolases, lipid biosynthesis, pathogenesis, and secondary metabolism to prevent the blast disease in rice, Pusa-Basmati-1 [10]. This might be suggested that the Pi9 gene was one of the major regulatory genes for rice blast defense mechanisms.

Additionally, the Pib gene was found the greatest distribution in PLK germplasms (40.00%), followed by STI germplasms (30.00%) and PCT germplasms (11.63%), respectively (Figure 7). The Pib gene is only one R gene located on chromosome 2 at the distal end of the long arm, which shows high resistance to a broad spectrum of many Japanese blast races [32–34]. Based on molecular genetics, the NBS region in the N-terminal of the Pib protein was modified by adding the kinase 1a, 2, and 3a motifs, and eight cysteine residues were clustered in the middle of the LRRs which have not been reported for other R genes [16].

Another R gene, the Pi-ta, was found the highest distribution in PLK germplasm (40.00%), followed by STI germplasms (35.00%) and PCT germplasms (18.60%), respectively. The Pi-ta gene, located near the centromere on chromosome 12 of rice, encodes a cytoplasmic membrane receptor protein with NBS-LRR domains [11]. These domains enable directly interact with neutral zinc metalloprotease, translated from an avirulent-Pi-ta (AVR-Pi-ta) gene [12], leading to disease resistance responses [13]. Other publications had been reported that the Pi-ta gene was linked to other resistance genes which often found a broad spectrum of blast resistance in Pi-ta rice varieties [11, 35–37]. Correspondingly, this study found that Pi-ta varieties show other R genes as 64.28% (18 of 28 Pi-ta varieties) (Figure 7). A similar trend of other R gene distribution might be found in these landrace rice. Therefore, the Pi-ta gene might be used as the first gene marker for the preliminary screening of rice blast resistance gene in rice breeding program.

The summarised R gene distributions found that the R genes were different distributions that relied on rice germplasms (Figure 7). The rice cultivars collected from PLK and STI germplasms were higher distribution of the blast resistance genes than the PCT germplasms. The three areas are individually isolated because of physical natural barriers, e.g., rivers, great distances, mountains. These physical barriers prevent them from regularly mating, which leads to a process of divergence. One possible explanation is that the R genes might assist their survival and natural selection of land rice under different environmental conditions [38]. According to Vejchasarn et al. [39], the rice population structure varied because of a special ecological system, genetic makeup, and agronomic features.

This was supported by observations that the landraces had a long history of coevolution between plants and pathogens [3, 40, 41], and the distribution of resistance genes and rice blasts was closely related [42]. The evolution of the R genes correlated together with the pathogenic variability [2]. However, the R gene mutations were offend found in Oryza sativa such as the additional mutation in Pi54 gene of the most japonica and some indica cultivars, resulting in the loss function of the nucleotide-binding site and leucine-rich repeat (NBS–LRR) domains [41]. Moreover, the single amino acid altered in the Pi-ta resistance protein [11, 43] might lead to the disruption of the protein-protein interaction between the Pi-ta protein and its associated protein [35]. It was denoted that the genetic diversity source of the R gene is required in supported by observations for sustainably new cultivars. The high variation of the R genes found in PLK and STI germplasms would be helpful for R-gene evolution study and rice breeding program to prevent the rapid breakdown of rice blast pathogens and to create rice resistance cultivation to rice blast disease [2].

3.2. Rice Varieties Containing All Tested R Genes

Of 98 tested rice varieties, 34 varieties contained one R gene, and 11 varieties contained two R genes while three R genes (Pi9, Pib, and Pi-ta) were presented in 8 varieties including 6 PLK varieties: No. 46 (Phong), 47 (Khao Loi Yai), 48 (Lamyai), 51 (Kwian Hak/Rot Lak), 66 (Pin Thong), and 76 (Kaen Chan), and 2 STI varieties: No. 81 (Chi Ma O) and 90 (Mueang Khaek) (Figure 6). This suggests that the rice germplasms, carrying all three R genes, might be useful for the rice breeding program due to providing the combined function of invasive defense against blast pathogens in rice. In order to control the disease, it has been recommended that developing rice cultivars resistant to blast disease is an alternative strategy [44]. According to Jiang et al. [45], the presence of multiple R genes results in a higher efficiency of pathogen control. Their study found a positive correlation between the number of R genes and the improved resistance to rice blast disease. However, all of those three R genes were absent in 44 rice varieties (44.90%), observed in 24 PCT varieties, 13 PLK varieties, and 7 STI varieties (Figure 5). The results revealed that the undetected R genes by the specific primers in these specimens simultaneously occurred in landrace rice germplasms, indicating that the R genes in rice might be missing to inherit during the evaluation process such as propagations and selections. This result also showed that the R genes were highly distributed in more than half of the STI varieties (65.00%) and in the PLK varieties (62.86%) whereas the presence of the R gene was low in the PCT varieties (44.19%). In agreement with previous findings, the genetic diversity of rice blast resistance gene within indica, japonica, and wild rice revealed that the Pib and Pi9 genes were the intermediate diversity whereas the Pi-ta gene was relatively conserved [21]. Although these three R genes encoded the same types of protein, namely nucleotide-binding site leucine-rich repeat (NBS-LRR) [9], their functions were different in particular disease resistance mechanisms.

In this study, the finding provided R genes divergence, associated with blast resistance across landrace rice cultivars in lower northern Thailand. This could be essentially beneficial as genetic resources to improve sustainable rice cultivars with blast resistance in the future.

4. Conclusions

This research reports the screening of the R genes (Pi9, Pib, and Pi-ta) related to blast disease in 98 landrace rice varieties collected which is the highest number from the lower northern region of Thailand (Phichit, Phitsanulok, and Sukhothai germplasms). The result of positive PCR amplification revealed that of these rice varieties, 34 varieties contained only one R gene, and 11 varieties obtained two R genes, whereas especially 8 varieties from PLK and STI germplasms carried all three studied R genes. This indicated that the landrace rice varieties collected from PLK and STI germplasms could be important genetic resources of the R genes for the further rice breeding program of blast resistance cultivar rice.

Although the presence of the R genes in the cultivar rice could prevent the pathogen invasion, the rapid revolution of the pathogen might affect the defense mechanisms of the pathogen control. Therefore, these findings could be utilised for selecting landrace rice varieties in rice breeding program to improve blast resistance in rice cultivars worldwide.

Data Availability

The data supporting the current study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors’ Contributions

S.U., J.J., and T.J. conceptualized the study; S.U., N.R., J.J., and T.J. provided methodology; S.U., J.J., and T.J. validated the study, did formal analysis, and investigated the study; S.U. and T.J. collected resources; S.U., K.S., U.S., N.R., J.J., and T.J. curated the data; S.U., K.S., U.S., N.R., J.J., and T.J. wrote the original draft; S.U., K.S., U.S., N.R., J.J., and T.J. wrote the manuscript and reviewed and edited the manuscript; S.U., J.J., and T.J. visualized the study, supervised the manuscript, and did project administration; S.U., J.J., and T.J did funding acquisition. All authors have read and agreed to the published version of the manuscript.

Acknowledgments

This research was financially supported by a grant from Research Fund from the Research and Development Institute Pibulsongkram Rajabhat University (Grant nos. RDI-2-63-28, RDI-2-64-37, RDI-2-65-48, and RDI-2-65-47). This research was also partly funded by the Global and Frontier Research University (Grant no. R2566C052), Naresuan University. The authors would like to thank the Phitsanulok Rice Research Center for kindly providing rice samples and the Science Center, Faculty of Science and Technology, Pibulsongkram Rajabhat University.

References

V. Nizolli, C. Pegoraro, and A. Costa de Oliveira, “Rice blast: strategies and challenges for improving genetic resistance,” Crop Breeding and Applied Biotechnology, vol. 21, 2021.
View at: Publisher Site | Google Scholar
Z. Ying, W. Tao, Y. Bin et al., “Improving rice blast resistance by mining broad-spectrum resistance genes at Pik Locus,” Rice Science, vol. 29, no. 2, pp. 133–142, 2022.
View at: Publisher Site | Google Scholar
H. Qi, J. Yang, C. Yin et al., “Analysis of pyricularia oryzae and p. grisea from different hosts based on multilocus phylogeny and pathogenicity associated with host preference in China,” Phytopathology, vol. 109, no. 8, pp. 1433–1440, 2019.
View at: Publisher Site | Google Scholar
A. Kunova, C. Pizzatti, and P. Cortesi, “Impact of tricyclazole and azoxystrobin on growth, sporulation and secondary infection of the rice blast fungus, Magnaporthe oryzae: Magnaporthe oryzae responses to tricyclazole and azoxystrobin,” Pest Management Science, vol. 69, no. 2, pp. 278–284, 2013.
View at: Publisher Site | Google Scholar
T. Ho Thi Thu, C. Nguyen Ngoc Bao, T. Nguyen Phuong, J. Chatchawan, and Q. Nguyen Bao, “Analyzing sequence variation of the avirulence Avr-Pita1 gene of rice blast isolates, Magnaporthe oryzae in vietnam,” Agriculture and Natural Resources, vol. 53, pp. 20–25, 2019.
View at: Google Scholar
S. R. Devi, K. Singh, B. Umakanth et al., “Development and identification of novel rice blast resistant sources and their characterization using molecular markers,” Rice Science, vol. 22, no. 6, pp. 300–308, 2015.
View at: Publisher Site | Google Scholar
C. Sooklim, P. Chomnunti, C. Jantasuriyarat, E. Chukeatirote, R. Nilthong, and S. Nilthong, “Genetic diversity and population structure of blast resistance genes in Thai upland rice germplasm,” European Journal of Plant Pathology, vol. 163, no. 3, pp. 587–599, 2022.
View at: Publisher Site | Google Scholar
W. Li, M. Chern, J. Yin, J. Wang, and X. Chen, “Recent advances in broad-spectrum resistance to the rice blast disease,” Current Opinion in Plant Biology, vol. 50, pp. 114–120, 2019.
View at: Publisher Site | Google Scholar
N. Xiao, Y. Wu, C. Pan et al., “Improving of rice blast resistances in japonica by pyramiding major R genes,” Frontiers of Plant Science, vol. 7, p. 1918, 2016.
View at: Publisher Site | Google Scholar
P. Jain, P. K. Singh, R. Kapoor et al., “Understanding host-pathogen interactions with expression profiling of NILs carrying rice-blast resistance Pi9 Gene,” Frontiers of Plant Science, vol. 8, p. 93, 2017.
View at: Publisher Site | Google Scholar
G. T. Bryan, K.-S. Wu, L. Farrall et al., “A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta,” The Plant Cell, vol. 12, no. 11, pp. 2033–2045, 2000.
View at: Publisher Site | Google Scholar
Y. Jia, S. A. McAdams, G. T. Bryan, H. P. Hershey, and B. Valent, “Direct interaction of resistance gene and avirulence gene products confers rice blast resistance,” The EMBO Journal, vol. 19, no. 15, pp. 4004–4014, 2000.
View at: Publisher Site | Google Scholar
M. J. Orbach, L. Farrall, J. A. Sweigard, F. G. Chumley, and B. Valent, “A telomeric avirulence gene determines efficacy for the rice blast resistance gene Pi-ta,” The Plant Cell, vol. 12, no. 11, pp. 2019–2032, 2000.
View at: Publisher Site | Google Scholar
Z. H. Yu, D. J. Mackill, J. M. Bonman, and S. D. Tanksley, “Tagging genes for blast resistance in rice via linkage to RFLP markers,” Theoretical and Applied Genetics, vol. 81, no. 4, pp. 471–476, 1991.
View at: Publisher Site | Google Scholar
G. Liu, G. Lu, L. Zeng, and G. L. Wang, “Two broad-spectrum blast resistance genes, Pi9(t) and Pi2(t), are physically linked on rice chromosome 6,” Molecular Genetics and Genomics, vol. 267, no. 4, pp. 472–480, 2002.
View at: Publisher Site | Google Scholar
Z. X. Wang, M. Yano, U. Yamanouchi et al., “The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes,” The Plant Journal, vol. 19, no. 1, pp. 55–64, 1999.
View at: Publisher Site | Google Scholar
R. Fjellstrom, C. A. Conaway-Bormans, A. M. McClung, M. A. Marchetti, A. R. Shank, and W. D. Park, “Development of DNA markers suitable for marker assisted selection of three Pi genes conferring resistance to multiple Pyricularia grisea pathotypes,” Crop Science, vol. 44, no. 5, pp. 1790–1798, 2004.
View at: Publisher Site | Google Scholar
Y. Jia, Z. Wang, and P. Singh, “Development of dominant rice blast Pi-ta resistance gene markers,” Crop Science, vol. 42, no. 6, pp. 2145–2149, 2002.
View at: Publisher Site | Google Scholar
V. Kanjoo, S. Jearakongman, K. Punyawaew et al., “Co-location of quantitative trait loci for drought and salinity tolerance in rice,” Thai Journal of Genetics, vol. 4, pp. 126–138, 2011.
View at: Publisher Site | Google Scholar
L. Goh, E. T.-J. Chong, J. Wong et al., “Molecular identification of blast resistance and pathogenesis-related genes in various traditional paddy varieties from different divisions of Sabah, East Malaysia,” International Food Research Journal, vol. 25, pp. 626–631, 2018.
View at: Google Scholar
X.-Q. Liu, J.-L. Wei, J.-C. Zhang et al., “Genetic variation of rice blast resistance genes in Oryza sativa and its wild relatives,” International Journal of Plant Sciences, vol. 172, no. 8, pp. 970–979, 2011.
View at: Publisher Site | Google Scholar
N. Thi Thu Thuy, H. Truong, T. Nguyen Long, and N. Hoang Khanh Linh, “Identification of rice blast resistance genes in South central coast of vietnam using monogenic lines under field condition and pathogenicity assays,” Journal of Agriculture, Science and Technology, vol. 5, pp. 491–500, 2015.
View at: Publisher Site | Google Scholar
L. Yan, Y. Bai-Yuan, P. Yun-Liang et al., “Molecular scree ning of blast resistance genes in rice germplasms resistant to Magnaporthe oryzae,” Rice Science, vol. 24, no. 1, pp. 41–47, 2017.
View at: Publisher Site | Google Scholar
S. Songtanasak, Agricultural Statistics of Thailand 2020; Office of Agricultural Economics, Ministry of Agriculture and Cooperatives: Bangkok, Bangkok, Thailand, 2021.
P. Skamnioti and S. J. Gurr, “Against the grain: safeguarding rice from rice blast disease,” Trends in Biotechnology, vol. 27, no. 3, pp. 141–150, 2009.
View at: Publisher Site | Google Scholar
J. J. Doyle and J. L. Doyle, “A rapid DNA isolation procedure for small quantities of fresh leaf tissue,” Phytochemical Bulletin, vol. 19, pp. 11–15, 1987.
View at: Google Scholar
K. Mullis, F. Faloona, S. Scharf, R. Saiki, G. Horn, and H. Erlich, “Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction,” Cold Spring Harbor Symposia on Quantitative Biology, vol. 51, pp. 263–273, 1986.
View at: Publisher Site | Google Scholar
M. Park, H. K. Yim, H. G. Park, J. Lim, S. H. Kim, and Y. S. Hwang, “Interference with oxidative phosphorylation enhances anoxic expression of rice alpha-amylase genes through abolishing sugar regulation,” Journal of Experimental Botany, vol. 61, no. 12, pp. 3235–3244, 2010.
View at: Publisher Site | Google Scholar
W. Teerasan, P. Moonsap, A. Longya et al., “Rice blast resistance gene profiling of Thai, Japanese and international rice varieties using gene-specific markers,” Plant Genetic Resources, vol. 20, no. 1, pp. 22–28, 2022.
View at: Publisher Site | Google Scholar
K. Phaitreejit, E. O. Srikaew, C. Jantasuriyarat, T. Sriwongchai, and S. Kate-ngam, “Screening Thai landrace rice for blast resistance gene Pi9, Pi36, Pigm(t) using DNA markers,” Thai Journal of Genetics, vol. 4, pp. 52–62, 2011.
View at: Google Scholar
C. Krainart, R. Siangsai, A. Longya, S. Sinumporn, and S. Talumphai, “Screening for rice blast resistant genes, Pi9, Pita, Pigm(t) and Pi54 in landrace rice varieties of northeastern Thailand,” Journal of Applied Research on Science and Technology, vol. 21, pp. 122–132, 2022.
View at: Google Scholar
K. Rybka, M. Miyamoto, I. Ando, A. Saito, and S. Kawasaki, “High resolution mapping of the indica-derived rice blast resistance genes II. Pi-ta2 and Pi-ta and a consideration of their origin,” Molecular Plant-Microbe Interactions, vol. 10, no. 4, pp. 517–524, 1997.
View at: Publisher Site | Google Scholar
L. Monna, A. Miyao, H. S. Zhong et al., “Saturation mapping with subclones of YACs: DNA marker production targeting the rice blast disease resistance gene, Pi-b,” Theoretical and Applied Genetics, vol. 94, no. 2, pp. 170–176, 1997.
View at: Publisher Site | Google Scholar
H. Shinoda, K. Toriyama, T. Yunoki, A. Ezuka, and Y. Sakurai, “Studies in the varietal resistance of rice to blast. 6. linkage relationship of blast resistance genes (in Japanese with English summary),” Bulletin of Chugoku National Agriculture Experimental Station: Series A, vol. 20, pp. 1–25, 1917.
View at: Google Scholar
Y. Jia, Z. Wang, R. G. Fjellstrom et al., “Rice Pi-ta gene confers resistance to the major pathotypes of the rice blast fungus in the United States,” Phytopathology, vol. 94, no. 3, pp. 296–301, 2004.
View at: Publisher Site | Google Scholar
J. Ma, Y. Sun, Y. Yang, J. Li, and X. Minghui, “Distribution of Pita gene for rice blast resistance in the rice cultivars (lines) from China Japan and Korea,” Molecular Plant Breeding, vol. 18, pp. 459–465, 2020.
View at: Google Scholar
K. Shi, C. L. Lei, Z. J. Cheng, X. T. Xu, J. L. Wang, and J. M. Wan, “Distribution of two blast resistance genes Pita and Pib in major rice cultivars in China,” Plant Genetic Resources, vol. 10, pp. 21–26, 2009.
View at: Google Scholar
J. Y. Song, G.-A. Lee, Y.-M. Choi et al., “Blast resistant genes distribution and resistance reaction to blast in Korean landraces of rice (Oryza sativa L.),” Korean Journal of Polar Research, vol. 27, no. 6, pp. 687–700, 2014.
View at: Publisher Site | Google Scholar
P. Vejchasarn, J. R. Shearman, U. Chaiprom et al., “Population structure of nation-wide rice in Thailand,” Rice, vol. 14, no. 1, p. 88, 2021.
View at: Publisher Site | Google Scholar
S. K. Mutiga, F. Rotich, V. D. Ganeshan et al., “Assessment of the virulence spectrum and its association with genetic diversity in Magnaporthe oryzae populations from Sub-Saharan africa,” Phytopathology, vol. 107, no. 7, pp. 852–863, 2017.
View at: Publisher Site | Google Scholar
L. Zhang, Y. Nakagomi, T. Endo et al., “Divergent evolution of rice blast resistance Pi54 locus in the genus Oryza,” Rice, vol. 11, no. 1, p. 63, 2018.
View at: Publisher Site | Google Scholar
J. Li, D. Q. Li, Y. Sun, and M. Xu, “Rice blast resistance gene Pi1 identified by MRG4766 marker in 173 yunnan rice landraces,” Proceedings of the Rice Genomics and Genetics, vol. 3, pp. 13–18, 2012.
View at: Google Scholar
Y. Jia, G. T. Bryan, L. Farrall, and B. Valent, “Natural variation at the Pi-ta rice blast resistance locus,” Phytopathology, vol. 93, no. 11, pp. 1452–1459, 2003.
View at: Publisher Site | Google Scholar
G. S. Khush and K. K. Jena, “Current status and future prospects for research on blast resistance in rice (Oryza sativa L.),” in Proceedings of the Advances in Genetics, pp. 1–10, Genomics and Control of Rice Blast Disease, Dordrecht, 2009.
View at: Google Scholar
H. Jiang, Z. Li, J. Liu et al., “Development and evaluation of improved lines with broad-spectrum resistance to rice blast using nine resistance genes,” Rice, vol. 12, no. 1, p. 29, 2019.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2023 Sittichai Urtgam et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

611

Downloads

476

Citations