Table 1: PCR and iPLEX primers used for genotyping of rs1021261 and rs3772130 by multiplex PCR and MALDI-TOF mass spectrometry.

PrimerSequence (5′-3′)

LUZP2 rs1021261
PCR forwardACGTTGGATGTTCCCACAAAGGATTTGCAG
PCR reverseACGTTGGATGCTGAAAGAATTTGTGTGAGAC
iPLEX extensionCTCCTCATTCAGGGAAGAAAG

FBXO40 rs3772130
PCR forwardACGTTGGATGTCTCATGGTAAACCTGTTGG
PCR reverseACGTTGGATGGGAAGAAATTCAACAGTGAG
iPLEX extensionAGATTGACCTAAATGGGCA