International Journal of Endocrinology / 2018 / Article / Tab 1

Research Article

Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)

Table 1

PCR primer sequences of the SEDL gene.

PCR primerForward/reversePrimers (5-3)

SEDL P1FAGGGAACGTGAACGTCTGAAA
RTCTTCAGCTCGGGAAGGCTAT
SEDL P2FCCGAGGGTTCGGGAGGAACAAAG
RCAGCGGAGGGCTGGCAGGTC
SEDL P3FCGGATGTTGGTCCTGTACCTC
RATCAAGGCCCCGATAAAGACA
SEDL P4FCATGAGAATGTTGTCTTTGTGATTTC
RCGGCAATCCACTACAGGTGA
SEDL P5FTCGGTAACTTCCTTCTTGAAACATGA
RAAATCACCCTTGATAGGGTCCA
SEDL P6FTCTGGACCCTATCAAGGGTGA
RCCCTAATAAAATCAGCTATGAGGACA
SEDL P7FAATGTGGTCTTTAGACTTTGGAATG
RCAAAAGTTTTCCAGGCTATTTAATCA

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.