International Journal of Endocrinology / 2019 / Article / Tab 1

Research Article

Effects of Exposure to Bisphenol A during Pregnancy on the Pup Testis Function

Table 1

Primers are used for real-time PCR analysis.

GeneForward primerReverse primer

CYP11A1GACCATCCTCCTTATCAATCTCTCCAGCCTTCAGTTCAC
StARGTCCTTATGGCTGCTTATCTTCCTGAAGTTGTCCTCTGA
3β-HSDCTGCTGCTGCTACTACTGAGAACTGTGGAAGGATGGT
BaxAGACAGGGGCCTTTTTGCTAAATTCGCCGGAGACACTCG
Bcl-2CTTTGAGTTCGGTGGGGTCAAGTTCCACAAAGGCATCCCA
GAPDHAACTTTGGCATTGTGGAAGGACACATTGGGGGTAGGAACA

a and b primers are from references [22, 23], respectively.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.