Research Article

Recurrent Germline Mutations of CHEK2 as a New Susceptibility Gene in Patients with Pheochromocytomas and Paragangliomas

Table 1

PCR primers for four CHEK2 germline mutations.

PrimerUpstreamDownstream

Exon 2ACTTTTTAATTTTAAGTCTTGAACGTGCCAAAAACCTGGAC
Exon 6GCCCTTGACATTTTACACTCAAATTCATCCATCTAAGCAGG
Intron 9TTGTTTTATTGTCTTCTGTCCAATTTTAATCCACGGTCCCTC
Nested PCR
Exon 11–15CGACGGCCAGTCTCAAGAAGAGGACTGTCTTGCTATGACCATGCACAAAGCCCAGGTTCCATC
Exon 11GCAAGTTCAACATTATTCCCTTTTATCACCTCCTACCAGTCTGTGC

(a) The condition of PCR amplification for Exon 2, 6, and Intron 9 was as follows: predenaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 54°C/52°C/64°C for 30 s, and extension at 72°C for 40 s. A total of 35 cycles were carried out, final extension at 72°C for 10 min. (b) The condition of nested PCR amplification for Exon 11 was as follows: (1) long-range PCR: predenaturation at 98°C for 5 min, denaturation at 95°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 3 min. A total of 35 cycles were carried out, final extension at 72°C for 10 min. Product of long-range PCR was used as a template to amplify the exon 11 using the appropriate oligonucleotide primers. (2) The condition of PCR amplification with the touch-down PCR was as follows: predenaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 64°C for 1 min (decreased by 0.5°C per cycle), and extension at 72°C for 40 s in 9 cycles, and, next, predenaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 1 min, and extension at 72°C for 40 s in 25 cycles. A total of 34 cycles were carried out, final extension at 72°C for 10 min. (c) PCR products were identified by 1.5% agarose gel electrophoresis and sent to the Beijing SinoGenoMax Company for purification and sequencing. The sequencing was performed by ABI 3730XL instrument.