Research Article

Recurrent Germline Mutations of CHEK2 as a New Susceptibility Gene in Patients with Pheochromocytomas and Paragangliomas

Table 2

PCR primers for CHEK2 mutations in somatic DNA from FFPE tissues.

PrimerUpstreamDownstream

2S300CACTGAGCTCCTTAGAGACCAAGATTGGCAAATCCATC
6S770TTTGTTTTTCCCTCTAGTGGTATTATTTTGGGAAGTTATGAAG
9S41980GAGCTGTTTGACAAAGTGGTGTTTTAATCCACGGTCCCT

(a) The condition of PCR amplification was as follows: predenaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 56°C/52°C/56°C for 30 s, and extension at 72°C for 30 s. A total of 35 cycles were carried out, final extension at 72°C for 10 min. (b) PCR products were identified by 1.5% agarose gel electrophoresis and sent to the Beijing SinoGenoMax Company for purification and sequencing. The sequencing was performed by ABI 3730XL instrument.