Research Article
cpDNA-Gene-Sequence-Based Genetic Diversity, Population Structure, and Gene Flow Analysis of Ethiopian Lowland Bamboo (Bambusinea: Oxytenanthera abyssinica (A. Rich.) Munro)
Table 2
cpDNA primer sequences, their approximate amplified size, and PCR profile.
| Primer name | Amplified size (bp) | Primer sets | Amplification pattern | PCR profile (all end with 4°C hold) |
| matK | ∼ 1,350 | F: CGTTCTGACCATATTGCACTATG R: AACTAGTCGGATGGAGTAG | Excellent | 96°C, 3 min.; 35X (96°C, 30 sec., 53, 30 sec., 72°C 1 min.); 72°C, 20 min | ndhF | ∼ 1,140 | F: GTCTCAATTGGGTTATATGATG R: CCCCCTAYATATTTGATACCTTCTCC | Excellent | rps16 | ∼ 860 | F: AAACGATGTGGTARAAAGCAAC R: AACATCWATTGCAASGATTCGATA | Excellent |
|
|