International Journal of Genomics / 2014 / Article / Tab 1

Research Article

Isolation and Characterisation of PRSV-P Resistance Genes in Carica and Vasconcellea

Table 1

Primer sequence used in RACE-PCR and nested-PCR.

PrimerForward-primerReverse-primerTargeted genes
to be amplified

gsp2AATCGCCGTAGAGGAGGAGG28.106 (STK106)
gsp1AATCGCCGTAGGAAAATTC
ngsp2_106GCATATCCAAGAACGCAAGG
ngsp1_106TCTCCGCCCGAACATGTTCAACC

gsp2_105TGAAATTTGATGAGGTGGAACCTCC28.105 (STK105)
gsp1_105TGATGCGAACCTTTGACAGC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.