Table 1: Primer sequence used in RACE-PCR and nested-PCR.

PrimerForward-primerReverse-primerTargeted genes
to be amplified

gsp2AATCGCCGTAGAGGAGGAGG28.106 (STK106)
gsp1AATCGCCGTAGGAAAATTC
ngsp2_106GCATATCCAAGAACGCAAGG
ngsp1_106TCTCCGCCCGAACATGTTCAACC

gsp2_105TGAAATTTGATGAGGTGGAACCTCC28.105 (STK105)
gsp1_105TGATGCGAACCTTTGACAGC