Table 1: Primers pairs used for genotyping. Forward (F) and reverse (R) primers are indicated. WT refers to the RT-PCR product size in wild-type samples and KO refers to the product size in knockout DMR1-U2 transgenic mouse.

PrimerSequence ( )Product

F_K0AAGTTCCTCGGGTTGTAGGG
R_K0CTAGAGCAGTGTGGGGGTGT582 bp (WT)
R_K0_controlTTGGCTAGAAGGCGAAAGAA374 bp (KO)