International Journal of Genomics / 2018 / Article / Tab 2

Research Article

The β-Lactamase Gene Profile and a Plasmid-Carrying Multiple Heavy Metal Resistance Genes of Enterobacter cloacae

Table 2

Primers used in the study for the detection of β-lactamase-encoding genes.

PrimerTarget(s)Sequence (5-3)Annealing temperature (°C)Amplicon size (bp)Reference

veb-sfblaVEBGATTGCTTTAGCCGTTTTGTC50452[15]
veb-srATCGGTTACTTCCTGTTGTTGTTTC
z-sfblaZACAGTTCACATGCCAAAGAGT50479[16]
z-srCTTACCGAAAGCAGCAGGTG
mir-sfblaMIRGCCGCACCGATGTCCGAAAAA50545[18]
mir-srGGTTTAAAGACCCGCGTCGTCATGG
azecl-29-sfblaAZECL-29GTCTTTACGCTAACACCAGCATCGG50381[17]
azecl-29-srTCAGCATTTCCCAGCCCAATC
veb-ffblaVEBCGGGATCCATGAAAATCGTAAAAAGGATATTAT50918This study
veb-frCCCAAGCTTTATTTATTCAAATAGTAATTCCACG
z-ffblaZCGGGATCCATGAAAAAGTTAATATTTTTAATTG50864This study
z-frCCCAAGCTTTAAAATTCCTTCATTACACTCTTG
mir-ffblaMIRCGGGATCCATGATGACAAAATCCCTAAGCTGTG661164This study
mir-frCCCAAGCTTTACTGCAGCGCGTCGAGGATACGG
azecl-29-ffblaAZECL-29CGGAATTCATGATGAAAAAAAACCTAAGCTGTG601164This study
azecl-29-frCCCAAGCTTTACTGCAGCGCGTCGAGGATACG
ctx-m-9a-ffblaCTX-M-9aCGGGATCCATGGTGACAAAGAGAGTGCAACGGA60876This study
ctx-m-9a-frCCAAGCTTTTACAGCCCTTCGGCGATGATTCTC
shv-12-ffblaSHV-12CGGGATCCGTGGTTATGCGTTATATTCGCCTGT60867This study
shv-12-frCCAAGCTTTTAGCGTTGCCAGTGCTCGATCAGC

Underlined sequences denote restriction endonuclease sites. sf: forward screening primer; sr: reverse screening primer; ff: forward full-length primer; fr: reverse full-length primer.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.