Table 1: Nucleotide sequences of primers used in real-time PCR.

GenePrimersLengths (bp)Temp (°C)

LPLCGCTCCATCCATCTCTTC15949.8
GGCTCTGACCTTGTTGAT49.2
ACSL1GCAGTTCATCGGCATCTT10950.6
GGTTCCAAGCGTGTCATA49.8
ACADMATTACGGAAGAGTTGGCATA16654.15
GTTCTGTCACGCAGTAGG55.12
ME1AAGAACCTAGAAGCCATTGT10454.23
GCAGCCATATCCTTGAGAA54.62
TFB2MAGAATGCGGATGGAGAGT14155.20
CTGCTGACCAAGGAACTG55.27
MMP2AAGTCTGAAGAGTGTGAAGT18053.86
GTGAAGGAGAAGGCTGATT54.45
ALOX15CTCAGGCTTGCTACTTCAT15854.57
CTTCTCCATTGTTGCTTCC53.97
BAXGATGATTGCTGATGTGGATAC8650.50
AGTTGAAGTTGCCGTCTG50.40
GPX1CAATCAGTTCGGACATCAG13353.52
AGCCTTCTCACCATTCAC54.14
MMP23GATGGTCCTACAGGTGAAC19554.59
CTGGTCTTGCTGTGAGTG55.30
GAPDHTTCAACGGCACAGTCAAG11650.70
TACTCAGCACCAGCATCA50.50