Table 2: PCR primer sequences.

Degradation enzymePrimer sequence (5-3)Annealing temperature (°C)Length of the genes

Catechol 1,2-dioxygenaseF: ATGAACCGTCAACAAATTGATGC55907 bp
R: GGCGTCGTTCAACTTCGCTAG
DioxygenaseF: TGGTTCTCCCATGCTCGCTCT55700 bp
R: ATTCCTAGAGCCCCCATAGAAAAAC
7α-Hydroxysteroid dehydrogenaseF: ATGTATCAGTCCCTATTAGATTTATCC55774 bp
R: TTAATCAAGGGTTTGTACTCCG